Contract Source Code (Solidity Standard Json-Input format)

IDE

• Blockscan IDE
• 🤖 Code ReaderBeta
• Remix IDE

More Options

• Similar
• Sol2Uml
• Submit Audit
• Compare

// SPDX-License-Identifier: MIT
pragma solidity 0.8.6;

import "@openzeppelin/contracts/access/Ownable.sol";
import "@openzeppelin/contracts/security/ReentrancyGuard.sol";
import "@openzeppelin/contracts/token/ERC721/extensions/ERC721Enumerable.sol";
import "./core/NPassCore.sol";
import "./interfaces/IN.sol";

/**@title Nth Planet
***@author @nth_planet (inspired by @t_snark and @knaveth)*/

contract NthPlanet is NPassCore {
    using Strings for uint256;

    constructor(address _nContractAddress) NPassCore("Nth Planet", "NTH", IN(_nContractAddress), 
    false, 10000, 8888, 25000000000000000, 50000000000000000) {}

    string constant GEN_FRAGMENT_1 = "https://nthpla.net/api/generate?sample=";
    string constant GEN_FRAGMENT_2 = "+intensity=";

    function dnaGenerator(uint256 tokenId) public view virtual returns (uint256, string memory) {
        string memory dna;

        uint256 total = n.getFirst(tokenId) + n.getSecond(tokenId);
        total = total + n.getThird(tokenId);
        total = total + n.getFourth(tokenId);
        total = total + n.getFifth(tokenId);
        total = total + n.getSixth(tokenId);
        total = total + n.getSeventh(tokenId);
        total = total + n.getEight(tokenId);

        if (total >= 40 && total <= 50) {
            dna = "ctggtgatgggctgtttattgaacaacaatatcgctgacactagtgacagacagcctcta";
        } else if (total >= 35 && total <= 55) {
            dna = "ggaggtttaccccgccctcgtgacgtcagactgctcccactggagtagtcacaagacacc";
        } else if (total >= 29 && total <= 61) {
            dna = "tacgctatatctcccacccccgcgatcttggctccgctaaacacactcagggtaacaccg";
        } else if (total >= 24 && total <= 66) {
            dna = "gctagacgaaagtccccgtggaccaccgtacacaactctattacctccaagttgcagacg";
        } else {
            dna = "ggactttaactccatacaaaaacgtagacgctcccccaattgaagctgaggcattaaata";
        }

        return (total / 10, dna);
    }

    function characterGenerator(uint256 tokenId) public view virtual returns (string memory) {
        require(_exists(tokenId), "ERC721Metadata: URI query for nonexistent token");

        (uint256 total, string memory dna) = dnaGenerator(tokenId);

        string[14] memory parts;
        parts[0] = GEN_FRAGMENT_1;
        parts[1] = dna;
        parts[2] = GEN_FRAGMENT_2;
        parts[3] = total.toString();

        string memory output = string(abi.encodePacked(parts[0], parts[1], parts[2], parts[3]));
        return output;
    }

    function tokenURI(uint256 tokenId) public view virtual override returns (string memory) {
            require(_exists(tokenId), "ERC721Metadata: URI query for nonexistent token");

            string memory output = "null";
            string memory baseURI = "https://nth-planet-api.herokuapp.com/api/token/";
            output = string(abi.encodePacked(baseURI, tokenId.toString()));

            return output;
    }

    function toString(uint256 value) internal pure returns (string memory) {

        if (value == 0) {
            return "0";
        }
        uint256 temp = value;
        uint256 digits;
        while (temp != 0) {
            digits++;
            temp /= 10;
        }
        bytes memory buffer = new bytes(digits);
        while (value != 0) {
            digits -= 1;
            buffer[digits] = bytes1(uint8(48 + uint256(value % 10)));
            value /= 10;
        }
        return string(buffer);
    }
}

library Base64 {
    bytes internal constant TABLE = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";

    function encode(bytes memory data) internal pure returns (string memory) {
        uint256 len = data.length;
        if (len == 0) return "";

        uint256 encodedLen = 4 * ((len + 2) / 3);

        bytes memory result = new bytes(encodedLen + 32);

        bytes memory table = TABLE;

        assembly {
            let tablePtr := add(table, 1)
            let resultPtr := add(result, 32)

            for {
                let i := 0
            } lt(i, len) {

            } {
                i := add(i, 3)
                let input := and(mload(add(data, i)), 0xffffff)

                let out := mload(add(tablePtr, and(shr(18, input), 0x3F)))
                out := shl(8, out)
                out := add(out, and(mload(add(tablePtr, and(shr(12, input), 0x3F))), 0xFF))
                out := shl(8, out)
                out := add(out, and(mload(add(tablePtr, and(shr(6, input), 0x3F))), 0xFF))
                out := shl(8, out)
                out := add(out, and(mload(add(tablePtr, and(input, 0x3F))), 0xFF))
                out := shl(224, out)

                mstore(resultPtr, out)

                resultPtr := add(resultPtr, 4)
            }

            switch mod(len, 3)
            case 1 {
                mstore(sub(resultPtr, 2), shl(240, 0x3d3d))
            }
            case 2 {
                mstore(sub(resultPtr, 1), shl(248, 0x3d))
            }

            mstore(result, encodedLen)
        }

        return string(result);
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "../utils/Context.sol";

/**
 * @dev Contract module which provides a basic access control mechanism, where
 * there is an account (an owner) that can be granted exclusive access to
 * specific functions.
 *
 * By default, the owner account will be the one that deploys the contract. This
 * can later be changed with {transferOwnership}.
 *
 * This module is used through inheritance. It will make available the modifier
 * `onlyOwner`, which can be applied to your functions to restrict their use to
 * the owner.
 */
abstract contract Ownable is Context {
    address private _owner;

    event OwnershipTransferred(address indexed previousOwner, address indexed newOwner);

    /**
     * @dev Initializes the contract setting the deployer as the initial owner.
     */
    constructor() {
        _setOwner(_msgSender());
    }

    /**
     * @dev Returns the address of the current owner.
     */
    function owner() public view virtual returns (address) {
        return _owner;
    }

    /**
     * @dev Throws if called by any account other than the owner.
     */
    modifier onlyOwner() {
        require(owner() == _msgSender(), "Ownable: caller is not the owner");
        _;
    }

    /**
     * @dev Leaves the contract without owner. It will not be possible to call
     * `onlyOwner` functions anymore. Can only be called by the current owner.
     *
     * NOTE: Renouncing ownership will leave the contract without an owner,
     * thereby removing any functionality that is only available to the owner.
     */
    function renounceOwnership() public virtual onlyOwner {
        _setOwner(address(0));
    }

    /**
     * @dev Transfers ownership of the contract to a new account (`newOwner`).
     * Can only be called by the current owner.
     */
    function transferOwnership(address newOwner) public virtual onlyOwner {
        require(newOwner != address(0), "Ownable: new owner is the zero address");
        _setOwner(newOwner);
    }

    function _setOwner(address newOwner) private {
        address oldOwner = _owner;
        _owner = newOwner;
        emit OwnershipTransferred(oldOwner, newOwner);
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @dev Contract module that helps prevent reentrant calls to a function.
 *
 * Inheriting from `ReentrancyGuard` will make the {nonReentrant} modifier
 * available, which can be applied to functions to make sure there are no nested
 * (reentrant) calls to them.
 *
 * Note that because there is a single `nonReentrant` guard, functions marked as
 * `nonReentrant` may not call one another. This can be worked around by making
 * those functions `private`, and then adding `external` `nonReentrant` entry
 * points to them.
 *
 * TIP: If you would like to learn more about reentrancy and alternative ways
 * to protect against it, check out our blog post
 * https://blog.openzeppelin.com/reentrancy-after-istanbul/[Reentrancy After Istanbul].
 */
abstract contract ReentrancyGuard {
    // Booleans are more expensive than uint256 or any type that takes up a full
    // word because each write operation emits an extra SLOAD to first read the
    // slot's contents, replace the bits taken up by the boolean, and then write
    // back. This is the compiler's defense against contract upgrades and
    // pointer aliasing, and it cannot be disabled.

    // The values being non-zero value makes deployment a bit more expensive,
    // but in exchange the refund on every call to nonReentrant will be lower in
    // amount. Since refunds are capped to a percentage of the total
    // transaction's gas, it is best to keep them low in cases like this one, to
    // increase the likelihood of the full refund coming into effect.
    uint256 private constant _NOT_ENTERED = 1;
    uint256 private constant _ENTERED = 2;

    uint256 private _status;

    constructor() {
        _status = _NOT_ENTERED;
    }

    /**
     * @dev Prevents a contract from calling itself, directly or indirectly.
     * Calling a `nonReentrant` function from another `nonReentrant`
     * function is not supported. It is possible to prevent this from happening
     * by making the `nonReentrant` function external, and make it call a
     * `private` function that does the actual work.
     */
    modifier nonReentrant() {
        // On the first call to nonReentrant, _notEntered will be true
        require(_status != _ENTERED, "ReentrancyGuard: reentrant call");

        // Any calls to nonReentrant after this point will fail
        _status = _ENTERED;

        _;

        // By storing the original value once again, a refund is triggered (see
        // https://eips.ethereum.org/EIPS/eip-2200)
        _status = _NOT_ENTERED;
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "./IERC721.sol";
import "./IERC721Receiver.sol";
import "./extensions/IERC721Metadata.sol";
import "../../utils/Address.sol";
import "../../utils/Context.sol";
import "../../utils/Strings.sol";
import "../../utils/introspection/ERC165.sol";

/**
 * @dev Implementation of https://eips.ethereum.org/EIPS/eip-721[ERC721] Non-Fungible Token Standard, including
 * the Metadata extension, but not including the Enumerable extension, which is available separately as
 * {ERC721Enumerable}.
 */
contract ERC721 is Context, ERC165, IERC721, IERC721Metadata {
    using Address for address;
    using Strings for uint256;

    // Token name
    string private _name;

    // Token symbol
    string private _symbol;

    // Mapping from token ID to owner address
    mapping(uint256 => address) private _owners;

    // Mapping owner address to token count
    mapping(address => uint256) private _balances;

    // Mapping from token ID to approved address
    mapping(uint256 => address) private _tokenApprovals;

    // Mapping from owner to operator approvals
    mapping(address => mapping(address => bool)) private _operatorApprovals;

    /**
     * @dev Initializes the contract by setting a `name` and a `symbol` to the token collection.
     */
    constructor(string memory name_, string memory symbol_) {
        _name = name_;
        _symbol = symbol_;
    }

    /**
     * @dev See {IERC165-supportsInterface}.
     */
    function supportsInterface(bytes4 interfaceId) public view virtual override(ERC165, IERC165) returns (bool) {
        return
            interfaceId == type(IERC721).interfaceId ||
            interfaceId == type(IERC721Metadata).interfaceId ||
            super.supportsInterface(interfaceId);
    }

    /**
     * @dev See {IERC721-balanceOf}.
     */
    function balanceOf(address owner) public view virtual override returns (uint256) {
        require(owner != address(0), "ERC721: balance query for the zero address");
        return _balances[owner];
    }

    /**
     * @dev See {IERC721-ownerOf}.
     */
    function ownerOf(uint256 tokenId) public view virtual override returns (address) {
        address owner = _owners[tokenId];
        require(owner != address(0), "ERC721: owner query for nonexistent token");
        return owner;
    }

    /**
     * @dev See {IERC721Metadata-name}.
     */
    function name() public view virtual override returns (string memory) {
        return _name;
    }

    /**
     * @dev See {IERC721Metadata-symbol}.
     */
    function symbol() public view virtual override returns (string memory) {
        return _symbol;
    }

    /**
     * @dev See {IERC721Metadata-tokenURI}.
     */
    function tokenURI(uint256 tokenId) public view virtual override returns (string memory) {
        require(_exists(tokenId), "ERC721Metadata: URI query for nonexistent token");

        string memory baseURI = _baseURI();
        return bytes(baseURI).length > 0 ? string(abi.encodePacked(baseURI, tokenId.toString())) : "";
    }

    /**
     * @dev Base URI for computing {tokenURI}. If set, the resulting URI for each
     * token will be the concatenation of the `baseURI` and the `tokenId`. Empty
     * by default, can be overriden in child contracts.
     */
    function _baseURI() internal view virtual returns (string memory) {
        return "";
    }

    /**
     * @dev See {IERC721-approve}.
     */
    function approve(address to, uint256 tokenId) public virtual override {
        address owner = ERC721.ownerOf(tokenId);
        require(to != owner, "ERC721: approval to current owner");

        require(
            _msgSender() == owner || isApprovedForAll(owner, _msgSender()),
            "ERC721: approve caller is not owner nor approved for all"
        );

        _approve(to, tokenId);
    }

    /**
     * @dev See {IERC721-getApproved}.
     */
    function getApproved(uint256 tokenId) public view virtual override returns (address) {
        require(_exists(tokenId), "ERC721: approved query for nonexistent token");

        return _tokenApprovals[tokenId];
    }

    /**
     * @dev See {IERC721-setApprovalForAll}.
     */
    function setApprovalForAll(address operator, bool approved) public virtual override {
        require(operator != _msgSender(), "ERC721: approve to caller");

        _operatorApprovals[_msgSender()][operator] = approved;
        emit ApprovalForAll(_msgSender(), operator, approved);
    }

    /**
     * @dev See {IERC721-isApprovedForAll}.
     */
    function isApprovedForAll(address owner, address operator) public view virtual override returns (bool) {
        return _operatorApprovals[owner][operator];
    }

    /**
     * @dev See {IERC721-transferFrom}.
     */
    function transferFrom(
        address from,
        address to,
        uint256 tokenId
    ) public virtual override {
        //solhint-disable-next-line max-line-length
        require(_isApprovedOrOwner(_msgSender(), tokenId), "ERC721: transfer caller is not owner nor approved");

        _transfer(from, to, tokenId);
    }

    /**
     * @dev See {IERC721-safeTransferFrom}.
     */
    function safeTransferFrom(
        address from,
        address to,
        uint256 tokenId
    ) public virtual override {
        safeTransferFrom(from, to, tokenId, "");
    }

    /**
     * @dev See {IERC721-safeTransferFrom}.
     */
    function safeTransferFrom(
        address from,
        address to,
        uint256 tokenId,
        bytes memory _data
    ) public virtual override {
        require(_isApprovedOrOwner(_msgSender(), tokenId), "ERC721: transfer caller is not owner nor approved");
        _safeTransfer(from, to, tokenId, _data);
    }

    /**
     * @dev Safely transfers `tokenId` token from `from` to `to`, checking first that contract recipients
     * are aware of the ERC721 protocol to prevent tokens from being forever locked.
     *
     * `_data` is additional data, it has no specified format and it is sent in call to `to`.
     *
     * This internal function is equivalent to {safeTransferFrom}, and can be used to e.g.
     * implement alternative mechanisms to perform token transfer, such as signature-based.
     *
     * Requirements:
     *
     * - `from` cannot be the zero address.
     * - `to` cannot be the zero address.
     * - `tokenId` token must exist and be owned by `from`.
     * - If `to` refers to a smart contract, it must implement {IERC721Receiver-onERC721Received}, which is called upon a safe transfer.
     *
     * Emits a {Transfer} event.
     */
    function _safeTransfer(
        address from,
        address to,
        uint256 tokenId,
        bytes memory _data
    ) internal virtual {
        _transfer(from, to, tokenId);
        require(_checkOnERC721Received(from, to, tokenId, _data), "ERC721: transfer to non ERC721Receiver implementer");
    }

    /**
     * @dev Returns whether `tokenId` exists.
     *
     * Tokens can be managed by their owner or approved accounts via {approve} or {setApprovalForAll}.
     *
     * Tokens start existing when they are minted (`_mint`),
     * and stop existing when they are burned (`_burn`).
     */
    function _exists(uint256 tokenId) internal view virtual returns (bool) {
        return _owners[tokenId] != address(0);
    }

    /**
     * @dev Returns whether `spender` is allowed to manage `tokenId`.
     *
     * Requirements:
     *
     * - `tokenId` must exist.
     */
    function _isApprovedOrOwner(address spender, uint256 tokenId) internal view virtual returns (bool) {
        require(_exists(tokenId), "ERC721: operator query for nonexistent token");
        address owner = ERC721.ownerOf(tokenId);
        return (spender == owner || getApproved(tokenId) == spender || isApprovedForAll(owner, spender));
    }

    /**
     * @dev Safely mints `tokenId` and transfers it to `to`.
     *
     * Requirements:
     *
     * - `tokenId` must not exist.
     * - If `to` refers to a smart contract, it must implement {IERC721Receiver-onERC721Received}, which is called upon a safe transfer.
     *
     * Emits a {Transfer} event.
     */
    function _safeMint(address to, uint256 tokenId) internal virtual {
        _safeMint(to, tokenId, "");
    }

    /**
     * @dev Same as {xref-ERC721-_safeMint-address-uint256-}[`_safeMint`], with an additional `data` parameter which is
     * forwarded in {IERC721Receiver-onERC721Received} to contract recipients.
     */
    function _safeMint(
        address to,
        uint256 tokenId,
        bytes memory _data
    ) internal virtual {
        _mint(to, tokenId);
        require(
            _checkOnERC721Received(address(0), to, tokenId, _data),
            "ERC721: transfer to non ERC721Receiver implementer"
        );
    }

    /**
     * @dev Mints `tokenId` and transfers it to `to`.
     *
     * WARNING: Usage of this method is discouraged, use {_safeMint} whenever possible
     *
     * Requirements:
     *
     * - `tokenId` must not exist.
     * - `to` cannot be the zero address.
     *
     * Emits a {Transfer} event.
     */
    function _mint(address to, uint256 tokenId) internal virtual {
        require(to != address(0), "ERC721: mint to the zero address");
        require(!_exists(tokenId), "ERC721: token already minted");

        _beforeTokenTransfer(address(0), to, tokenId);

        _balances[to] += 1;
        _owners[tokenId] = to;

        emit Transfer(address(0), to, tokenId);
    }

    /**
     * @dev Destroys `tokenId`.
     * The approval is cleared when the token is burned.
     *
     * Requirements:
     *
     * - `tokenId` must exist.
     *
     * Emits a {Transfer} event.
     */
    function _burn(uint256 tokenId) internal virtual {
        address owner = ERC721.ownerOf(tokenId);

        _beforeTokenTransfer(owner, address(0), tokenId);

        // Clear approvals
        _approve(address(0), tokenId);

        _balances[owner] -= 1;
        delete _owners[tokenId];

        emit Transfer(owner, address(0), tokenId);
    }

    /**
     * @dev Transfers `tokenId` from `from` to `to`.
     *  As opposed to {transferFrom}, this imposes no restrictions on msg.sender.
     *
     * Requirements:
     *
     * - `to` cannot be the zero address.
     * - `tokenId` token must be owned by `from`.
     *
     * Emits a {Transfer} event.
     */
    function _transfer(
        address from,
        address to,
        uint256 tokenId
    ) internal virtual {
        require(ERC721.ownerOf(tokenId) == from, "ERC721: transfer of token that is not own");
        require(to != address(0), "ERC721: transfer to the zero address");

        _beforeTokenTransfer(from, to, tokenId);

        // Clear approvals from the previous owner
        _approve(address(0), tokenId);

        _balances[from] -= 1;
        _balances[to] += 1;
        _owners[tokenId] = to;

        emit Transfer(from, to, tokenId);
    }

    /**
     * @dev Approve `to` to operate on `tokenId`
     *
     * Emits a {Approval} event.
     */
    function _approve(address to, uint256 tokenId) internal virtual {
        _tokenApprovals[tokenId] = to;
        emit Approval(ERC721.ownerOf(tokenId), to, tokenId);
    }

    /**
     * @dev Internal function to invoke {IERC721Receiver-onERC721Received} on a target address.
     * The call is not executed if the target address is not a contract.
     *
     * @param from address representing the previous owner of the given token ID
     * @param to target address that will receive the tokens
     * @param tokenId uint256 ID of the token to be transferred
     * @param _data bytes optional data to send along with the call
     * @return bool whether the call correctly returned the expected magic value
     */
    function _checkOnERC721Received(
        address from,
        address to,
        uint256 tokenId,
        bytes memory _data
    ) private returns (bool) {
        if (to.isContract()) {
            try IERC721Receiver(to).onERC721Received(_msgSender(), from, tokenId, _data) returns (bytes4 retval) {
                return retval == IERC721Receiver.onERC721Received.selector;
            } catch (bytes memory reason) {
                if (reason.length == 0) {
                    revert("ERC721: transfer to non ERC721Receiver implementer");
                } else {
                    assembly {
                        revert(add(32, reason), mload(reason))
                    }
                }
            }
        } else {
            return true;
        }
    }

    /**
     * @dev Hook that is called before any token transfer. This includes minting
     * and burning.
     *
     * Calling conditions:
     *
     * - When `from` and `to` are both non-zero, ``from``'s `tokenId` will be
     * transferred to `to`.
     * - When `from` is zero, `tokenId` will be minted for `to`.
     * - When `to` is zero, ``from``'s `tokenId` will be burned.
     * - `from` and `to` are never both zero.
     *
     * To learn more about hooks, head to xref:ROOT:extending-contracts.adoc#using-hooks[Using Hooks].
     */
    function _beforeTokenTransfer(
        address from,
        address to,
        uint256 tokenId
    ) internal virtual {}
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "../../utils/introspection/IERC165.sol";

/**
 * @dev Required interface of an ERC721 compliant contract.
 */
interface IERC721 is IERC165 {
    /**
     * @dev Emitted when `tokenId` token is transferred from `from` to `to`.
     */
    event Transfer(address indexed from, address indexed to, uint256 indexed tokenId);

    /**
     * @dev Emitted when `owner` enables `approved` to manage the `tokenId` token.
     */
    event Approval(address indexed owner, address indexed approved, uint256 indexed tokenId);

    /**
     * @dev Emitted when `owner` enables or disables (`approved`) `operator` to manage all of its assets.
     */
    event ApprovalForAll(address indexed owner, address indexed operator, bool approved);

    /**
     * @dev Returns the number of tokens in ``owner``'s account.
     */
    function balanceOf(address owner) external view returns (uint256 balance);

    /**
     * @dev Returns the owner of the `tokenId` token.
     *
     * Requirements:
     *
     * - `tokenId` must exist.
     */
    function ownerOf(uint256 tokenId) external view returns (address owner);

    /**
     * @dev Safely transfers `tokenId` token from `from` to `to`, checking first that contract recipients
     * are aware of the ERC721 protocol to prevent tokens from being forever locked.
     *
     * Requirements:
     *
     * - `from` cannot be the zero address.
     * - `to` cannot be the zero address.
     * - `tokenId` token must exist and be owned by `from`.
     * - If the caller is not `from`, it must be have been allowed to move this token by either {approve} or {setApprovalForAll}.
     * - If `to` refers to a smart contract, it must implement {IERC721Receiver-onERC721Received}, which is called upon a safe transfer.
     *
     * Emits a {Transfer} event.
     */
    function safeTransferFrom(
        address from,
        address to,
        uint256 tokenId
    ) external;

    /**
     * @dev Transfers `tokenId` token from `from` to `to`.
     *
     * WARNING: Usage of this method is discouraged, use {safeTransferFrom} whenever possible.
     *
     * Requirements:
     *
     * - `from` cannot be the zero address.
     * - `to` cannot be the zero address.
     * - `tokenId` token must be owned by `from`.
     * - If the caller is not `from`, it must be approved to move this token by either {approve} or {setApprovalForAll}.
     *
     * Emits a {Transfer} event.
     */
    function transferFrom(
        address from,
        address to,
        uint256 tokenId
    ) external;

    /**
     * @dev Gives permission to `to` to transfer `tokenId` token to another account.
     * The approval is cleared when the token is transferred.
     *
     * Only a single account can be approved at a time, so approving the zero address clears previous approvals.
     *
     * Requirements:
     *
     * - The caller must own the token or be an approved operator.
     * - `tokenId` must exist.
     *
     * Emits an {Approval} event.
     */
    function approve(address to, uint256 tokenId) external;

    /**
     * @dev Returns the account approved for `tokenId` token.
     *
     * Requirements:
     *
     * - `tokenId` must exist.
     */
    function getApproved(uint256 tokenId) external view returns (address operator);

    /**
     * @dev Approve or remove `operator` as an operator for the caller.
     * Operators can call {transferFrom} or {safeTransferFrom} for any token owned by the caller.
     *
     * Requirements:
     *
     * - The `operator` cannot be the caller.
     *
     * Emits an {ApprovalForAll} event.
     */
    function setApprovalForAll(address operator, bool _approved) external;

    /**
     * @dev Returns if the `operator` is allowed to manage all of the assets of `owner`.
     *
     * See {setApprovalForAll}
     */
    function isApprovedForAll(address owner, address operator) external view returns (bool);

    /**
     * @dev Safely transfers `tokenId` token from `from` to `to`.
     *
     * Requirements:
     *
     * - `from` cannot be the zero address.
     * - `to` cannot be the zero address.
     * - `tokenId` token must exist and be owned by `from`.
     * - If the caller is not `from`, it must be approved to move this token by either {approve} or {setApprovalForAll}.
     * - If `to` refers to a smart contract, it must implement {IERC721Receiver-onERC721Received}, which is called upon a safe transfer.
     *
     * Emits a {Transfer} event.
     */
    function safeTransferFrom(
        address from,
        address to,
        uint256 tokenId,
        bytes calldata data
    ) external;
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @title ERC721 token receiver interface
 * @dev Interface for any contract that wants to support safeTransfers
 * from ERC721 asset contracts.
 */
interface IERC721Receiver {
    /**
     * @dev Whenever an {IERC721} `tokenId` token is transferred to this contract via {IERC721-safeTransferFrom}
     * by `operator` from `from`, this function is called.
     *
     * It must return its Solidity selector to confirm the token transfer.
     * If any other value is returned or the interface is not implemented by the recipient, the transfer will be reverted.
     *
     * The selector can be obtained in Solidity with `IERC721.onERC721Received.selector`.
     */
    function onERC721Received(
        address operator,
        address from,
        uint256 tokenId,
        bytes calldata data
    ) external returns (bytes4);
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "../ERC721.sol";
import "./IERC721Enumerable.sol";

/**
 * @dev This implements an optional extension of {ERC721} defined in the EIP that adds
 * enumerability of all the token ids in the contract as well as all token ids owned by each
 * account.
 */
abstract contract ERC721Enumerable is ERC721, IERC721Enumerable {
    // Mapping from owner to list of owned token IDs
    mapping(address => mapping(uint256 => uint256)) private _ownedTokens;

    // Mapping from token ID to index of the owner tokens list
    mapping(uint256 => uint256) private _ownedTokensIndex;

    // Array with all token ids, used for enumeration
    uint256[] private _allTokens;

    // Mapping from token id to position in the allTokens array
    mapping(uint256 => uint256) private _allTokensIndex;

    /**
     * @dev See {IERC165-supportsInterface}.
     */
    function supportsInterface(bytes4 interfaceId) public view virtual override(IERC165, ERC721) returns (bool) {
        return interfaceId == type(IERC721Enumerable).interfaceId || super.supportsInterface(interfaceId);
    }

    /**
     * @dev See {IERC721Enumerable-tokenOfOwnerByIndex}.
     */
    function tokenOfOwnerByIndex(address owner, uint256 index) public view virtual override returns (uint256) {
        require(index < ERC721.balanceOf(owner), "ERC721Enumerable: owner index out of bounds");
        return _ownedTokens[owner][index];
    }

    /**
     * @dev See {IERC721Enumerable-totalSupply}.
     */
    function totalSupply() public view virtual override returns (uint256) {
        return _allTokens.length;
    }

    /**
     * @dev See {IERC721Enumerable-tokenByIndex}.
     */
    function tokenByIndex(uint256 index) public view virtual override returns (uint256) {
        require(index < ERC721Enumerable.totalSupply(), "ERC721Enumerable: global index out of bounds");
        return _allTokens[index];
    }

    /**
     * @dev Hook that is called before any token transfer. This includes minting
     * and burning.
     *
     * Calling conditions:
     *
     * - When `from` and `to` are both non-zero, ``from``'s `tokenId` will be
     * transferred to `to`.
     * - When `from` is zero, `tokenId` will be minted for `to`.
     * - When `to` is zero, ``from``'s `tokenId` will be burned.
     * - `from` cannot be the zero address.
     * - `to` cannot be the zero address.
     *
     * To learn more about hooks, head to xref:ROOT:extending-contracts.adoc#using-hooks[Using Hooks].
     */
    function _beforeTokenTransfer(
        address from,
        address to,
        uint256 tokenId
    ) internal virtual override {
        super._beforeTokenTransfer(from, to, tokenId);

        if (from == address(0)) {
            _addTokenToAllTokensEnumeration(tokenId);
        } else if (from != to) {
            _removeTokenFromOwnerEnumeration(from, tokenId);
        }
        if (to == address(0)) {
            _removeTokenFromAllTokensEnumeration(tokenId);
        } else if (to != from) {
            _addTokenToOwnerEnumeration(to, tokenId);
        }
    }

    /**
     * @dev Private function to add a token to this extension's ownership-tracking data structures.
     * @param to address representing the new owner of the given token ID
     * @param tokenId uint256 ID of the token to be added to the tokens list of the given address
     */
    function _addTokenToOwnerEnumeration(address to, uint256 tokenId) private {
        uint256 length = ERC721.balanceOf(to);
        _ownedTokens[to][length] = tokenId;
        _ownedTokensIndex[tokenId] = length;
    }

    /**
     * @dev Private function to add a token to this extension's token tracking data structures.
     * @param tokenId uint256 ID of the token to be added to the tokens list
     */
    function _addTokenToAllTokensEnumeration(uint256 tokenId) private {
        _allTokensIndex[tokenId] = _allTokens.length;
        _allTokens.push(tokenId);
    }

    /**
     * @dev Private function to remove a token from this extension's ownership-tracking data structures. Note that
     * while the token is not assigned a new owner, the `_ownedTokensIndex` mapping is _not_ updated: this allows for
     * gas optimizations e.g. when performing a transfer operation (avoiding double writes).
     * This has O(1) time complexity, but alters the order of the _ownedTokens array.
     * @param from address representing the previous owner of the given token ID
     * @param tokenId uint256 ID of the token to be removed from the tokens list of the given address
     */
    function _removeTokenFromOwnerEnumeration(address from, uint256 tokenId) private {
        // To prevent a gap in from's tokens array, we store the last token in the index of the token to delete, and
        // then delete the last slot (swap and pop).

        uint256 lastTokenIndex = ERC721.balanceOf(from) - 1;
        uint256 tokenIndex = _ownedTokensIndex[tokenId];

        // When the token to delete is the last token, the swap operation is unnecessary
        if (tokenIndex != lastTokenIndex) {
            uint256 lastTokenId = _ownedTokens[from][lastTokenIndex];

            _ownedTokens[from][tokenIndex] = lastTokenId; // Move the last token to the slot of the to-delete token
            _ownedTokensIndex[lastTokenId] = tokenIndex; // Update the moved token's index
        }

        // This also deletes the contents at the last position of the array
        delete _ownedTokensIndex[tokenId];
        delete _ownedTokens[from][lastTokenIndex];
    }

    /**
     * @dev Private function to remove a token from this extension's token tracking data structures.
     * This has O(1) time complexity, but alters the order of the _allTokens array.
     * @param tokenId uint256 ID of the token to be removed from the tokens list
     */
    function _removeTokenFromAllTokensEnumeration(uint256 tokenId) private {
        // To prevent a gap in the tokens array, we store the last token in the index of the token to delete, and
        // then delete the last slot (swap and pop).

        uint256 lastTokenIndex = _allTokens.length - 1;
        uint256 tokenIndex = _allTokensIndex[tokenId];

        // When the token to delete is the last token, the swap operation is unnecessary. However, since this occurs so
        // rarely (when the last minted token is burnt) that we still do the swap here to avoid the gas cost of adding
        // an 'if' statement (like in _removeTokenFromOwnerEnumeration)
        uint256 lastTokenId = _allTokens[lastTokenIndex];

        _allTokens[tokenIndex] = lastTokenId; // Move the last token to the slot of the to-delete token
        _allTokensIndex[lastTokenId] = tokenIndex; // Update the moved token's index

        // This also deletes the contents at the last position of the array
        delete _allTokensIndex[tokenId];
        _allTokens.pop();
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "../IERC721.sol";

/**
 * @title ERC-721 Non-Fungible Token Standard, optional enumeration extension
 * @dev See https://eips.ethereum.org/EIPS/eip-721
 */
interface IERC721Enumerable is IERC721 {
    /**
     * @dev Returns the total amount of tokens stored by the contract.
     */
    function totalSupply() external view returns (uint256);

    /**
     * @dev Returns a token ID owned by `owner` at a given `index` of its token list.
     * Use along with {balanceOf} to enumerate all of ``owner``'s tokens.
     */
    function tokenOfOwnerByIndex(address owner, uint256 index) external view returns (uint256 tokenId);

    /**
     * @dev Returns a token ID at a given `index` of all the tokens stored by the contract.
     * Use along with {totalSupply} to enumerate all tokens.
     */
    function tokenByIndex(uint256 index) external view returns (uint256);
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "../IERC721.sol";

/**
 * @title ERC-721 Non-Fungible Token Standard, optional metadata extension
 * @dev See https://eips.ethereum.org/EIPS/eip-721
 */
interface IERC721Metadata is IERC721 {
    /**
     * @dev Returns the token collection name.
     */
    function name() external view returns (string memory);

    /**
     * @dev Returns the token collection symbol.
     */
    function symbol() external view returns (string memory);

    /**
     * @dev Returns the Uniform Resource Identifier (URI) for `tokenId` token.
     */
    function tokenURI(uint256 tokenId) external view returns (string memory);
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @dev Collection of functions related to the address type
 */
library Address {
    /**
     * @dev Returns true if `account` is a contract.
     *
     * [IMPORTANT]
     * ====
     * It is unsafe to assume that an address for which this function returns
     * false is an externally-owned account (EOA) and not a contract.
     *
     * Among others, `isContract` will return false for the following
     * types of addresses:
     *
     *  - an externally-owned account
     *  - a contract in construction
     *  - an address where a contract will be created
     *  - an address where a contract lived, but was destroyed
     * ====
     */
    function isContract(address account) internal view returns (bool) {
        // This method relies on extcodesize, which returns 0 for contracts in
        // construction, since the code is only stored at the end of the
        // constructor execution.

        uint256 size;
        assembly {
            size := extcodesize(account)
        }
        return size > 0;
    }

    /**
     * @dev Replacement for Solidity's `transfer`: sends `amount` wei to
     * `recipient`, forwarding all available gas and reverting on errors.
     *
     * https://eips.ethereum.org/EIPS/eip-1884[EIP1884] increases the gas cost
     * of certain opcodes, possibly making contracts go over the 2300 gas limit
     * imposed by `transfer`, making them unable to receive funds via
     * `transfer`. {sendValue} removes this limitation.
     *
     * https://diligence.consensys.net/posts/2019/09/stop-using-soliditys-transfer-now/[Learn more].
     *
     * IMPORTANT: because control is transferred to `recipient`, care must be
     * taken to not create reentrancy vulnerabilities. Consider using
     * {ReentrancyGuard} or the
     * https://solidity.readthedocs.io/en/v0.5.11/security-considerations.html#use-the-checks-effects-interactions-pattern[checks-effects-interactions pattern].
     */
    function sendValue(address payable recipient, uint256 amount) internal {
        require(address(this).balance >= amount, "Address: insufficient balance");

        (bool success, ) = recipient.call{value: amount}("");
        require(success, "Address: unable to send value, recipient may have reverted");
    }

    /**
     * @dev Performs a Solidity function call using a low level `call`. A
     * plain `call` is an unsafe replacement for a function call: use this
     * function instead.
     *
     * If `target` reverts with a revert reason, it is bubbled up by this
     * function (like regular Solidity function calls).
     *
     * Returns the raw returned data. To convert to the expected return value,
     * use https://solidity.readthedocs.io/en/latest/units-and-global-variables.html?highlight=abi.decode#abi-encoding-and-decoding-functions[`abi.decode`].
     *
     * Requirements:
     *
     * - `target` must be a contract.
     * - calling `target` with `data` must not revert.
     *
     * _Available since v3.1._
     */
    function functionCall(address target, bytes memory data) internal returns (bytes memory) {
        return functionCall(target, data, "Address: low-level call failed");
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-}[`functionCall`], but with
     * `errorMessage` as a fallback revert reason when `target` reverts.
     *
     * _Available since v3.1._
     */
    function functionCall(
        address target,
        bytes memory data,
        string memory errorMessage
    ) internal returns (bytes memory) {
        return functionCallWithValue(target, data, 0, errorMessage);
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-}[`functionCall`],
     * but also transferring `value` wei to `target`.
     *
     * Requirements:
     *
     * - the calling contract must have an ETH balance of at least `value`.
     * - the called Solidity function must be `payable`.
     *
     * _Available since v3.1._
     */
    function functionCallWithValue(
        address target,
        bytes memory data,
        uint256 value
    ) internal returns (bytes memory) {
        return functionCallWithValue(target, data, value, "Address: low-level call with value failed");
    }

    /**
     * @dev Same as {xref-Address-functionCallWithValue-address-bytes-uint256-}[`functionCallWithValue`], but
     * with `errorMessage` as a fallback revert reason when `target` reverts.
     *
     * _Available since v3.1._
     */
    function functionCallWithValue(
        address target,
        bytes memory data,
        uint256 value,
        string memory errorMessage
    ) internal returns (bytes memory) {
        require(address(this).balance >= value, "Address: insufficient balance for call");
        require(isContract(target), "Address: call to non-contract");

        (bool success, bytes memory returndata) = target.call{value: value}(data);
        return verifyCallResult(success, returndata, errorMessage);
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-}[`functionCall`],
     * but performing a static call.
     *
     * _Available since v3.3._
     */
    function functionStaticCall(address target, bytes memory data) internal view returns (bytes memory) {
        return functionStaticCall(target, data, "Address: low-level static call failed");
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-string-}[`functionCall`],
     * but performing a static call.
     *
     * _Available since v3.3._
     */
    function functionStaticCall(
        address target,
        bytes memory data,
        string memory errorMessage
    ) internal view returns (bytes memory) {
        require(isContract(target), "Address: static call to non-contract");

        (bool success, bytes memory returndata) = target.staticcall(data);
        return verifyCallResult(success, returndata, errorMessage);
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-}[`functionCall`],
     * but performing a delegate call.
     *
     * _Available since v3.4._
     */
    function functionDelegateCall(address target, bytes memory data) internal returns (bytes memory) {
        return functionDelegateCall(target, data, "Address: low-level delegate call failed");
    }

    /**
     * @dev Same as {xref-Address-functionCall-address-bytes-string-}[`functionCall`],
     * but performing a delegate call.
     *
     * _Available since v3.4._
     */
    function functionDelegateCall(
        address target,
        bytes memory data,
        string memory errorMessage
    ) internal returns (bytes memory) {
        require(isContract(target), "Address: delegate call to non-contract");

        (bool success, bytes memory returndata) = target.delegatecall(data);
        return verifyCallResult(success, returndata, errorMessage);
    }

    /**
     * @dev Tool to verifies that a low level call was successful, and revert if it wasn't, either by bubbling the
     * revert reason using the provided one.
     *
     * _Available since v4.3._
     */
    function verifyCallResult(
        bool success,
        bytes memory returndata,
        string memory errorMessage
    ) internal pure returns (bytes memory) {
        if (success) {
            return returndata;
        } else {
            // Look for revert reason and bubble it up if present
            if (returndata.length > 0) {
                // The easiest way to bubble the revert reason is using memory via assembly

                assembly {
                    let returndata_size := mload(returndata)
                    revert(add(32, returndata), returndata_size)
                }
            } else {
                revert(errorMessage);
            }
        }
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @dev Provides information about the current execution context, including the
 * sender of the transaction and its data. While these are generally available
 * via msg.sender and msg.data, they should not be accessed in such a direct
 * manner, since when dealing with meta-transactions the account sending and
 * paying for execution may not be the actual sender (as far as an application
 * is concerned).
 *
 * This contract is only required for intermediate, library-like contracts.
 */
abstract contract Context {
    function _msgSender() internal view virtual returns (address) {
        return msg.sender;
    }

    function _msgData() internal view virtual returns (bytes calldata) {
        return msg.data;
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @dev String operations.
 */
library Strings {
    bytes16 private constant _HEX_SYMBOLS = "0123456789abcdef";

    /**
     * @dev Converts a `uint256` to its ASCII `string` decimal representation.
     */
    function toString(uint256 value) internal pure returns (string memory) {
        // Inspired by OraclizeAPI's implementation - MIT licence
        // https://github.com/oraclize/ethereum-api/blob/b42146b063c7d6ee1358846c198246239e9360e8/oraclizeAPI_0.4.25.sol

        if (value == 0) {
            return "0";
        }
        uint256 temp = value;
        uint256 digits;
        while (temp != 0) {
            digits++;
            temp /= 10;
        }
        bytes memory buffer = new bytes(digits);
        while (value != 0) {
            digits -= 1;
            buffer[digits] = bytes1(uint8(48 + uint256(value % 10)));
            value /= 10;
        }
        return string(buffer);
    }

    /**
     * @dev Converts a `uint256` to its ASCII `string` hexadecimal representation.
     */
    function toHexString(uint256 value) internal pure returns (string memory) {
        if (value == 0) {
            return "0x00";
        }
        uint256 temp = value;
        uint256 length = 0;
        while (temp != 0) {
            length++;
            temp >>= 8;
        }
        return toHexString(value, length);
    }

    /**
     * @dev Converts a `uint256` to its ASCII `string` hexadecimal representation with fixed length.
     */
    function toHexString(uint256 value, uint256 length) internal pure returns (string memory) {
        bytes memory buffer = new bytes(2 * length + 2);
        buffer[0] = "0";
        buffer[1] = "x";
        for (uint256 i = 2 * length + 1; i > 1; --i) {
            buffer[i] = _HEX_SYMBOLS[value & 0xf];
            value >>= 4;
        }
        require(value == 0, "Strings: hex length insufficient");
        return string(buffer);
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

import "./IERC165.sol";

/**
 * @dev Implementation of the {IERC165} interface.
 *
 * Contracts that want to implement ERC165 should inherit from this contract and override {supportsInterface} to check
 * for the additional interface id that will be supported. For example:
 *
 * ```solidity
 * function supportsInterface(bytes4 interfaceId) public view virtual override returns (bool) {
 *     return interfaceId == type(MyInterface).interfaceId || super.supportsInterface(interfaceId);
 * }
 * ```
 *
 * Alternatively, {ERC165Storage} provides an easier to use but more expensive implementation.
 */
abstract contract ERC165 is IERC165 {
    /**
     * @dev See {IERC165-supportsInterface}.
     */
    function supportsInterface(bytes4 interfaceId) public view virtual override returns (bool) {
        return interfaceId == type(IERC165).interfaceId;
    }
}

// SPDX-License-Identifier: MIT

pragma solidity ^0.8.0;

/**
 * @dev Interface of the ERC165 standard, as defined in the
 * https://eips.ethereum.org/EIPS/eip-165[EIP].
 *
 * Implementers can declare support of contract interfaces, which can then be
 * queried by others ({ERC165Checker}).
 *
 * For an implementation, see {ERC165}.
 */
interface IERC165 {
    /**
     * @dev Returns true if this contract implements the interface defined by
     * `interfaceId`. See the corresponding
     * https://eips.ethereum.org/EIPS/eip-165#how-interfaces-are-identified[EIP section]
     * to learn more about how these ids are created.
     *
     * This function call must use less than 30 000 gas.
     */
    function supportsInterface(bytes4 interfaceId) external view returns (bool);
}

// SPDX-License-Identifier: MIT
pragma solidity 0.8.6;

import "@openzeppelin/contracts/token/ERC721/extensions/ERC721Enumerable.sol";
import "@openzeppelin/contracts/security/ReentrancyGuard.sol";
import "@openzeppelin/contracts/access/Ownable.sol";
import "../interfaces/IN.sol";

/**@title NPassCore contract
***@author Tony Snark*/

abstract contract NPassCore is ERC721Enumerable, ReentrancyGuard, Ownable {
    uint256 public constant MAX_MULTI_MINT_AMOUNT = 32;
    uint256 public constant MAX_N_TOKEN_ID = 8888;

    IN public immutable n;
    bool public immutable onlyNHolders;
    uint16 public immutable reservedAllowance;
    uint16 public reserveMinted;
    uint256 public immutable maxTotalSupply;
    uint256 public immutable priceForNHoldersInWei;
    uint256 public immutable priceForOpenMintInWei;

    /**
     * @notice Construct an NPassCore instance
     * @param name Name of the token
     * @param symbol Symbol of the token
     * @param n_ Address of your n instance (only for testing)
     * @param onlyNHolders_ True if only n tokens holders can mint this token
     * @param maxTotalSupply_ Maximum number of tokens that can ever be minted
     * @param reservedAllowance_ Number of tokens reserved for n token holders
     * @param priceForNHoldersInWei_ Price n token holders need to pay to mint
     * @param priceForOpenMintInWei_ Price open minter need to pay to mint
     */
    constructor(
        string memory name,
        string memory symbol,
        IN n_,
        bool onlyNHolders_,
        uint256 maxTotalSupply_,
        uint16 reservedAllowance_,
        uint256 priceForNHoldersInWei_,
        uint256 priceForOpenMintInWei_
    ) ERC721(name, symbol) {
        require(maxTotalSupply_ > 0, "NPass:INVALID_SUPPLY");
        require(!onlyNHolders_ || (onlyNHolders_ && maxTotalSupply_ <= MAX_N_TOKEN_ID), "NPass:INVALID_SUPPLY");
        require(maxTotalSupply_ >= reservedAllowance_, "NPass:INVALID_ALLOWANCE");
        // If restricted to n token holders we limit max total supply
        n = n_;
        onlyNHolders = onlyNHolders_;
        maxTotalSupply = maxTotalSupply_;
        reservedAllowance = reservedAllowance_;
        priceForNHoldersInWei = priceForNHoldersInWei_;
        priceForOpenMintInWei = priceForOpenMintInWei_;
    }

    /**
     * @notice Allow a n token holder to bulk mint tokens with id of their n tokens' id
     * @param tokenIds Ids to be minted
     */
    function multiMintWithN(uint256[] calldata tokenIds) public payable virtual nonReentrant {
        uint256 maxTokensToMint = tokenIds.length;
        require(maxTokensToMint <= MAX_MULTI_MINT_AMOUNT, "NPass:TOO_LARGE");
        require(
            // If no reserved allowance we respect total supply contraint
            (reservedAllowance == 0 && totalSupply() + maxTokensToMint <= maxTotalSupply) ||
                reserveMinted + maxTokensToMint <= reservedAllowance,
            "NPass:MAX_ALLOCATION_REACHED"
        );
        require(msg.value == priceForNHoldersInWei * maxTokensToMint, "NPass:INVALID_PRICE");
        // To avoid wasting gas we want to check all preconditions beforehand
        for (uint256 i = 0; i < maxTokensToMint; i++) {
            require(n.ownerOf(tokenIds[i]) == msg.sender, "NPass:INVALID_OWNER");
        }

        // If reserved allowance is active we track mints count
        if (reservedAllowance > 0) {
            reserveMinted += uint16(maxTokensToMint);
        }
        for (uint256 i = 0; i < maxTokensToMint; i++) {
            _safeMint(msg.sender, tokenIds[i]);
        }
    }

    /**
     * @notice Allow a n token holder to mint a token with one of their n token's id
     * @param tokenId Id to be minted
     */
    function mintWithN(uint256 tokenId) public payable virtual nonReentrant {
        require(
            // If no reserved allowance we respect total supply contraint
            (reservedAllowance == 0 && totalSupply() < maxTotalSupply) || reserveMinted < reservedAllowance,
            "NPass:MAX_ALLOCATION_REACHED"
        );
        require(n.ownerOf(tokenId) == msg.sender, "NPass:INVALID_OWNER");
        require(msg.value == priceForNHoldersInWei, "NPass:INVALID_PRICE");

        // If reserved allowance is active we track mints count
        if (reservedAllowance > 0) {
            reserveMinted++;
        }
        _safeMint(msg.sender, tokenId);
    }

    /**
     * @notice Allow anyone to mint a token with the supply id if this pass is unrestricted.
     *         n token holders can use this function without using the n token holders allowance,
     *         this is useful when the allowance is fully utilized.
     * @param tokenId Id to be minted
     */
    function mint(uint256 tokenId) public payable virtual nonReentrant {
        require(!onlyNHolders, "NPass:OPEN_MINTING_DISABLED");
        require(openMintsAvailable() > 0, "NPass:MAX_ALLOCATION_REACHED");
        require(
            (tokenId > MAX_N_TOKEN_ID && tokenId <= maxTokenId()) || n.ownerOf(tokenId) == msg.sender,
            "NPass:INVALID_ID"
        );
        require(msg.value == priceForOpenMintInWei, "NPass:INVALID_PRICE");

        _safeMint(msg.sender, tokenId);
    }

    /**
     * @notice Calculate the maximum token id that can ever be minted
     * @return Maximum token id
     */
    function maxTokenId() public view returns (uint256) {
        uint256 maxOpenMints = maxTotalSupply - reservedAllowance;
        return MAX_N_TOKEN_ID + maxOpenMints;
    }

    /**
     * @notice Calculate the currently available number of reserved tokens for n token holders
     * @return Reserved mint available
     */
    function nHoldersMintsAvailable() external view returns (uint256) {
        return reservedAllowance - reserveMinted;
    }

    /**
     * @notice Calculate the currently available number of open mints
     * @return Open mint available
     */
    function openMintsAvailable() public view returns (uint256) {
        uint256 maxOpenMints = maxTotalSupply - reservedAllowance;
        uint256 currentOpenMints = totalSupply() - reserveMinted;
        return maxOpenMints - currentOpenMints;
    }

    /**
     * @notice Allows owner to withdraw amount
     */
    function withdrawAll() external onlyOwner {
        payable(owner()).transfer(address(this).balance);
    }
}

// SPDX-License-Identifier: MIT
pragma solidity 0.8.6;
import "@openzeppelin/contracts/token/ERC721/extensions/IERC721Enumerable.sol";
import "@openzeppelin/contracts/token/ERC721/extensions/IERC721Metadata.sol";

interface IN is IERC721Enumerable, IERC721Metadata {
    function getFirst(uint256 tokenId) external view returns (uint256);

    function getSecond(uint256 tokenId) external view returns (uint256);

    function getThird(uint256 tokenId) external view returns (uint256);

    function getFourth(uint256 tokenId) external view returns (uint256);

    function getFifth(uint256 tokenId) external view returns (uint256);

    function getSixth(uint256 tokenId) external view returns (uint256);

    function getSeventh(uint256 tokenId) external view returns (uint256);

    function getEight(uint256 tokenId) external view returns (uint256);
}

{
  "evmVersion": "berlin",
  "libraries": {},
  "metadata": {
    "bytecodeHash": "none",
    "useLiteralContent": true
  },
  "optimizer": {
    "enabled": true,
    "runs": 800
  },
  "remappings": [],
  "outputSelection": {
    "*": {
      "*": [
        "evm.bytecode",
        "evm.deployedBytecode",
        "abi"
      ]
    }
  }
}

• No Contract Security Audit Submitted- Submit Audit Here

[{"inputs":[{"internalType":"address","name":"_nContractAddress","type":"address"}],"stateMutability":"nonpayable","type":"constructor"},{"anonymous":false,"inputs":[{"indexed":true,"internalType":"address","name":"owner","type":"address"},{"indexed":true,"internalType":"address","name":"approved","type":"address"},{"indexed":true,"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"Approval","type":"event"},{"anonymous":false,"inputs":[{"indexed":true,"internalType":"address","name":"owner","type":"address"},{"indexed":true,"internalType":"address","name":"operator","type":"address"},{"indexed":false,"internalType":"bool","name":"approved","type":"bool"}],"name":"ApprovalForAll","type":"event"},{"anonymous":false,"inputs":[{"indexed":true,"internalType":"address","name":"previousOwner","type":"address"},{"indexed":true,"internalType":"address","name":"newOwner","type":"address"}],"name":"OwnershipTransferred","type":"event"},{"anonymous":false,"inputs":[{"indexed":true,"internalType":"address","name":"from","type":"address"},{"indexed":true,"internalType":"address","name":"to","type":"address"},{"indexed":true,"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"Transfer","type":"event"},{"inputs":[],"name":"MAX_MULTI_MINT_AMOUNT","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"MAX_N_TOKEN_ID","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"address","name":"to","type":"address"},{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"approve","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[{"internalType":"address","name":"owner","type":"address"}],"name":"balanceOf","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"characterGenerator","outputs":[{"internalType":"string","name":"","type":"string"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"dnaGenerator","outputs":[{"internalType":"uint256","name":"","type":"uint256"},{"internalType":"string","name":"","type":"string"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"getApproved","outputs":[{"internalType":"address","name":"","type":"address"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"address","name":"owner","type":"address"},{"internalType":"address","name":"operator","type":"address"}],"name":"isApprovedForAll","outputs":[{"internalType":"bool","name":"","type":"bool"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"maxTokenId","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"maxTotalSupply","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"mint","outputs":[],"stateMutability":"payable","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"mintWithN","outputs":[],"stateMutability":"payable","type":"function"},{"inputs":[{"internalType":"uint256[]","name":"tokenIds","type":"uint256[]"}],"name":"multiMintWithN","outputs":[],"stateMutability":"payable","type":"function"},{"inputs":[],"name":"n","outputs":[{"internalType":"contract IN","name":"","type":"address"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"nHoldersMintsAvailable","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"name","outputs":[{"internalType":"string","name":"","type":"string"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"onlyNHolders","outputs":[{"internalType":"bool","name":"","type":"bool"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"openMintsAvailable","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"owner","outputs":[{"internalType":"address","name":"","type":"address"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"ownerOf","outputs":[{"internalType":"address","name":"","type":"address"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"priceForNHoldersInWei","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"priceForOpenMintInWei","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"renounceOwnership","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[],"name":"reserveMinted","outputs":[{"internalType":"uint16","name":"","type":"uint16"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"reservedAllowance","outputs":[{"internalType":"uint16","name":"","type":"uint16"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"address","name":"from","type":"address"},{"internalType":"address","name":"to","type":"address"},{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"safeTransferFrom","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[{"internalType":"address","name":"from","type":"address"},{"internalType":"address","name":"to","type":"address"},{"internalType":"uint256","name":"tokenId","type":"uint256"},{"internalType":"bytes","name":"_data","type":"bytes"}],"name":"safeTransferFrom","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[{"internalType":"address","name":"operator","type":"address"},{"internalType":"bool","name":"approved","type":"bool"}],"name":"setApprovalForAll","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[{"internalType":"bytes4","name":"interfaceId","type":"bytes4"}],"name":"supportsInterface","outputs":[{"internalType":"bool","name":"","type":"bool"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"symbol","outputs":[{"internalType":"string","name":"","type":"string"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"index","type":"uint256"}],"name":"tokenByIndex","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"address","name":"owner","type":"address"},{"internalType":"uint256","name":"index","type":"uint256"}],"name":"tokenOfOwnerByIndex","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"tokenURI","outputs":[{"internalType":"string","name":"","type":"string"}],"stateMutability":"view","type":"function"},{"inputs":[],"name":"totalSupply","outputs":[{"internalType":"uint256","name":"","type":"uint256"}],"stateMutability":"view","type":"function"},{"inputs":[{"internalType":"address","name":"from","type":"address"},{"internalType":"address","name":"to","type":"address"},{"internalType":"uint256","name":"tokenId","type":"uint256"}],"name":"transferFrom","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[{"internalType":"address","name":"newOwner","type":"address"}],"name":"transferOwnership","outputs":[],"stateMutability":"nonpayable","type":"function"},{"inputs":[],"name":"withdrawAll","outputs":[],"stateMutability":"nonpayable","type":"function"}]

6101406040523480156200001257600080fd5b5060405162003a7c38038062003a7c83398101604081905262000035916200031f565b6040518060400160405280600a815260200169139d1a08141b185b995d60b21b8152506040518060400160405280600381526020016209ca8960eb1b8152508260006127106122b86658d15e1762800066b1a2bc2ec5000087878160009080519060200190620000a792919062000279565b508051620000bd90600190602084019062000279565b50506001600a5550620000d03362000227565b60008411620001265760405162461bcd60e51b815260206004820152601460248201527f4e506173733a494e56414c49445f535550504c5900000000000000000000000060448201526064015b60405180910390fd5b8415806200013f57508480156200013f57506122b88411155b6200018d5760405162461bcd60e51b815260206004820152601460248201527f4e506173733a494e56414c49445f535550504c5900000000000000000000000060448201526064016200011d565b8261ffff16841015620001e35760405162461bcd60e51b815260206004820152601760248201527f4e506173733a494e56414c49445f414c4c4f57414e434500000000000000000060448201526064016200011d565b60609590951b6001600160601b03191660805292151560f81b60a05260e09190915260f01b6001600160f01b03191660c0526101005261012052506200038e915050565b600b80546001600160a01b038381166001600160a01b0319831681179093556040519116919082907f8be0079c531659141344cd1fd0a4f28419497f9722a3daafe3b4186f6b6457e090600090a35050565b828054620002879062000351565b90600052602060002090601f016020900481019282620002ab5760008555620002f6565b82601f10620002c657805160ff1916838001178555620002f6565b82800160010185558215620002f6579182015b82811115620002f6578251825591602001919060010190620002d9565b506200030492915062000308565b5090565b5b8082111562000304576000815560010162000309565b6000602082840312156200033257600080fd5b81516001600160a01b03811681146200034a57600080fd5b9392505050565b600181811c908216806200036657607f821691505b602082108114156200038857634e487b7160e01b600052602260045260246000fd5b50919050565b60805160601c60a05160f81c60c05160f01c60e05161010051610120516135d1620004ab6000396000818161076101526119500152600081816106c401528181610b03015261111c0152600081816103eb015281816109610152818161104e015281816115b901526116db015260008181610364015281816109370152818161099901528181610b6b0152818161102401528181611092015281816112b401528181611597015281816116b9015261215201526000818161051d015261177c01526000818161041f01528181610a31015281816111920152818161187d01528181611a8101528181611b3301528181611bd801528181611c7d01528181611d2201528181611dc701528181611e6c0152611f1101526135d16000f3fe60806040526004361061026a5760003560e01c80636a4c19d911610153578063a22cb465116100cb578063c87b56dd1161007f578063e985e9c511610064578063e985e9c5146106e6578063f2fde38b1461072f578063f82cbbe81461074f57600080fd5b8063c87b56dd14610692578063daf5d374146106b257600080fd5b8063ae5a583f116100b0578063ae5a583f14610647578063b88d4fde1461065d578063c5de34a01461067d57600080fd5b8063a22cb465146105f9578063ab84c4ed1461061957600080fd5b8063853828b61161012257806391ba317a1161010757806391ba317a146105bc57806395d89b41146105d1578063a0712d68146105e657600080fd5b8063853828b6146105895780638da5cb5b1461059e57600080fd5b80636a4c19d91461050b57806370a082311461053f578063715018a61461055f5780638416b6961461057457600080fd5b80632ab4d052116101e657806347febae8116101b55780634f6ccce71161019a5780634f6ccce7146104b65780635d929f70146104d65780636352211e146104eb57600080fd5b806347febae8146104815780634c81433f1461049457600080fd5b80632ab4d052146103d95780632e52d6061461040d5780632f745c591461044157806342842e0e1461046157600080fd5b8063095ea7b31161023d57806320bc84ce1161022257806320bc84ce1461035257806323b872dd14610399578063261ab1d7146103b957600080fd5b8063095ea7b31461031357806318160ddd1461033357600080fd5b806301ffc9a71461026f57806306fdde03146102a4578063081812fc146102c65780630860b12c146102fe575b600080fd5b34801561027b57600080fd5b5061028f61028a3660046130c9565b610783565b60405190151581526020015b60405180910390f35b3480156102b057600080fd5b506102b96107ae565b60405161029b9190613223565b3480156102d257600080fd5b506102e66102e1366004613103565b610840565b6040516001600160a01b03909116815260200161029b565b61031161030c366004613103565b6108da565b005b34801561031f57600080fd5b5061031161032e366004613028565b610bd9565b34801561033f57600080fd5b506008545b60405190815260200161029b565b34801561035e57600080fd5b506103867f000000000000000000000000000000000000000000000000000000000000000081565b60405161ffff909116815260200161029b565b3480156103a557600080fd5b506103116103b4366004612ed4565b610cef565b3480156103c557600080fd5b506102b96103d4366004613103565b610d76565b3480156103e557600080fd5b506103447f000000000000000000000000000000000000000000000000000000000000000081565b34801561041957600080fd5b506102e67f000000000000000000000000000000000000000000000000000000000000000081565b34801561044d57600080fd5b5061034461045c366004613028565b610eb2565b34801561046d57600080fd5b5061031161047c366004612ed4565b610f5a565b61031161048f366004613054565b610f75565b3480156104a057600080fd5b50600b5461038690600160a01b900461ffff1681565b3480156104c257600080fd5b506103446104d1366004613103565b61135d565b3480156104e257600080fd5b50610344602081565b3480156104f757600080fd5b506102e6610506366004613103565b611401565b34801561051757600080fd5b5061028f7f000000000000000000000000000000000000000000000000000000000000000081565b34801561054b57600080fd5b5061034461055a366004612e5a565b61148c565b34801561056b57600080fd5b50610311611526565b34801561058057600080fd5b5061034461158c565b34801561059557600080fd5b50610311611618565b3480156105aa57600080fd5b50600b546001600160a01b03166102e6565b3480156105c857600080fd5b506103446116ae565b3480156105dd57600080fd5b506102b9611713565b6103116105f4366004613103565b611722565b34801561060557600080fd5b50610311610614366004612ff5565b6119b3565b34801561062557600080fd5b50610639610634366004613103565b611a78565b60405161029b929190613236565b34801561065357600080fd5b506103446122b881565b34801561066957600080fd5b50610311610678366004612f15565b6120ad565b34801561068957600080fd5b5061034461213b565b34801561069e57600080fd5b506102b96106ad366004613103565b61217f565b3480156106be57600080fd5b506103447f000000000000000000000000000000000000000000000000000000000000000081565b3480156106f257600080fd5b5061028f610701366004612e9b565b6001600160a01b03918216600090815260056020908152604080832093909416825291909152205460ff1690565b34801561073b57600080fd5b5061031161074a366004612e5a565b61226f565b34801561075b57600080fd5b506103447f000000000000000000000000000000000000000000000000000000000000000081565b60006001600160e01b0319821663780e9d6360e01b14806107a857506107a88261234e565b92915050565b6060600080546107bd9061331d565b80601f01602080910402602001604051908101604052809291908181526020018280546107e99061331d565b80156108365780601f1061080b57610100808354040283529160200191610836565b820191906000526020600020905b81548152906001019060200180831161081957829003601f168201915b5050505050905090565b6000818152600260205260408120546001600160a01b03166108be5760405162461bcd60e51b815260206004820152602c60248201527f4552433732313a20617070726f76656420717565727920666f72206e6f6e657860448201526b34b9ba32b73a103a37b5b2b760a11b60648201526084015b60405180910390fd5b506000908152600460205260409020546001600160a01b031690565b6002600a54141561092d5760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a5561ffff7f00000000000000000000000000000000000000000000000000000000000000001615801561098b57507f000000000000000000000000000000000000000000000000000000000000000061098960085490565b105b806109c55750600b5461ffff7f00000000000000000000000000000000000000000000000000000000000000008116600160a01b90920416105b610a115760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b6040516331a9108f60e11b81526004810182905233906001600160a01b037f00000000000000000000000000000000000000000000000000000000000000001690636352211e9060240160206040518083038186803b158015610a7357600080fd5b505afa158015610a87573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190610aab9190612e7e565b6001600160a01b031614610b015760405162461bcd60e51b815260206004820152601360248201527f4e506173733a494e56414c49445f4f574e45520000000000000000000000000060448201526064016108b5565b7f00000000000000000000000000000000000000000000000000000000000000003414610b665760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b61ffff7f00000000000000000000000000000000000000000000000000000000000000001615610bc757600b8054600160a01b900461ffff16906014610bab83613358565b91906101000a81548161ffff021916908361ffff160217905550505b610bd1338261239e565b506001600a55565b6000610be482611401565b9050806001600160a01b0316836001600160a01b03161415610c525760405162461bcd60e51b815260206004820152602160248201527f4552433732313a20617070726f76616c20746f2063757272656e74206f776e656044820152603960f91b60648201526084016108b5565b336001600160a01b0382161480610c6e5750610c6e8133610701565b610ce05760405162461bcd60e51b815260206004820152603860248201527f4552433732313a20617070726f76652063616c6c6572206973206e6f74206f7760448201527f6e6572206e6f7220617070726f76656420666f7220616c6c000000000000000060648201526084016108b5565b610cea83836123bc565b505050565b610cf9338261242a565b610d6b5760405162461bcd60e51b815260206004820152603160248201527f4552433732313a207472616e736665722063616c6c6572206973206e6f74206f60448201527f776e6572206e6f7220617070726f76656400000000000000000000000000000060648201526084016108b5565b610cea838383612521565b6000818152600260205260409020546060906001600160a01b0316610df55760405162461bcd60e51b815260206004820152602f60248201527f4552433732314d657461646174613a2055524920717565727920666f72206e6f60448201526e3732bc34b9ba32b73a103a37b5b2b760891b60648201526084016108b5565b600080610e0184611a78565b91509150610e0d612e32565b6040518060600160405280602781526020016135336027913981526020808201839052604080518082018252600b81527f2b696e74656e736974793d00000000000000000000000000000000000000000092810192909252820152610e71836126e0565b6060820181905281516020808401516040808601519051600095610e989594909101613190565b60408051601f198184030181529190529695505050505050565b6000610ebd8361148c565b8210610f315760405162461bcd60e51b815260206004820152602b60248201527f455243373231456e756d657261626c653a206f776e657220696e646578206f7560448201527f74206f6620626f756e647300000000000000000000000000000000000000000060648201526084016108b5565b506001600160a01b03919091166000908152600660209081526040808320938352929052205490565b610cea838383604051806020016040528060008152506120ad565b6002600a541415610fc85760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a5580602081111561101f5760405162461bcd60e51b815260206004820152600f60248201527f4e506173733a544f4f5f4c41524745000000000000000000000000000000000060448201526064016108b5565b61ffff7f00000000000000000000000000000000000000000000000000000000000000001615801561108457507f00000000000000000000000000000000000000000000000000000000000000008161107760085490565b611081919061326c565b11155b806110ca5750600b5461ffff7f00000000000000000000000000000000000000000000000000000000000000008116916110c7918491600160a01b90041661326c565b11155b6111165760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b611140817f0000000000000000000000000000000000000000000000000000000000000000613298565b34146111845760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b60005b818110156112ae57337f00000000000000000000000000000000000000000000000000000000000000006001600160a01b0316636352211e8686858181106111d1576111d16133eb565b905060200201356040518263ffffffff1660e01b81526004016111f691815260200190565b60206040518083038186803b15801561120e57600080fd5b505afa158015611222573d6000803e3d6000fd5b505050506040513d601f19601f820116820180604052508101906112469190612e7e565b6001600160a01b03161461129c5760405162461bcd60e51b815260206004820152601360248201527f4e506173733a494e56414c49445f4f574e45520000000000000000000000000060448201526064016108b5565b806112a68161337a565b915050611187565b5061ffff7f000000000000000000000000000000000000000000000000000000000000000016156113135780600b60148282829054906101000a900461ffff166112f8919061324f565b92506101000a81548161ffff021916908361ffff1602179055505b60005b818110156113525761134033858584818110611334576113346133eb565b9050602002013561239e565b8061134a8161337a565b915050611316565b50506001600a555050565b600061136860085490565b82106113dc5760405162461bcd60e51b815260206004820152602c60248201527f455243373231456e756d657261626c653a20676c6f62616c20696e646578206f60448201527f7574206f6620626f756e6473000000000000000000000000000000000000000060648201526084016108b5565b600882815481106113ef576113ef6133eb565b90600052602060002001549050919050565b6000818152600260205260408120546001600160a01b0316806107a85760405162461bcd60e51b815260206004820152602960248201527f4552433732313a206f776e657220717565727920666f72206e6f6e657869737460448201527f656e7420746f6b656e000000000000000000000000000000000000000000000060648201526084016108b5565b60006001600160a01b03821661150a5760405162461bcd60e51b815260206004820152602a60248201527f4552433732313a2062616c616e636520717565727920666f7220746865207a6560448201527f726f20616464726573730000000000000000000000000000000000000000000060648201526084016108b5565b506001600160a01b031660009081526003602052604090205490565b600b546001600160a01b031633146115805760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b61158a60006127f6565b565b6000806115dd61ffff7f0000000000000000000000000000000000000000000000000000000000000000167f00000000000000000000000000000000000000000000000000000000000000006132da565b600b5490915060009061ffff600160a01b909104166115fb60085490565b61160591906132da565b905061161181836132da565b9250505090565b600b546001600160a01b031633146116725760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b600b546040516001600160a01b03909116904780156108fc02916000818181858888f193505050501580156116ab573d6000803e3d6000fd5b50565b6000806116ff61ffff7f0000000000000000000000000000000000000000000000000000000000000000167f00000000000000000000000000000000000000000000000000000000000000006132da565b905061170d816122b861326c565b91505090565b6060600180546107bd9061331d565b6002600a5414156117755760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a557f0000000000000000000000000000000000000000000000000000000000000000156117e85760405162461bcd60e51b815260206004820152601b60248201527f4e506173733a4f50454e5f4d494e54494e475f44495341424c4544000000000060448201526064016108b5565b60006117f261158c565b1161183f5760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b6122b88111801561185757506118536116ae565b8111155b8061190257506040516331a9108f60e11b81526004810182905233906001600160a01b037f00000000000000000000000000000000000000000000000000000000000000001690636352211e9060240160206040518083038186803b1580156118bf57600080fd5b505afa1580156118d3573d6000803e3d6000fd5b505050506040513d601f19601f820116820180604052508101906118f79190612e7e565b6001600160a01b0316145b61194e5760405162461bcd60e51b815260206004820152601060248201527f4e506173733a494e56414c49445f49440000000000000000000000000000000060448201526064016108b5565b7f00000000000000000000000000000000000000000000000000000000000000003414610bc75760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b6001600160a01b038216331415611a0c5760405162461bcd60e51b815260206004820152601960248201527f4552433732313a20617070726f766520746f2063616c6c65720000000000000060448201526064016108b5565b3360008181526005602090815260408083206001600160a01b03871680855290835292819020805460ff191686151590811790915590519081529192917f17307eab39ab6107e8899845ad3d59bd9653f200f220920489ca2b5937696c31910160405180910390a35050565b600060608060007f00000000000000000000000000000000000000000000000000000000000000006001600160a01b0316638aa001fc866040518263ffffffff1660e01b8152600401611acd91815260200190565b60206040518083038186803b158015611ae557600080fd5b505afa158015611af9573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611b1d919061311c565b60405163667386f760e01b8152600481018790527f00000000000000000000000000000000000000000000000000000000000000006001600160a01b03169063667386f79060240160206040518083038186803b158015611b7d57600080fd5b505afa158015611b91573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611bb5919061311c565b611bbf919061326c565b60405163fa7f71b160e01b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b03169063fa7f71b19060240160206040518083038186803b158015611c2257600080fd5b505afa158015611c36573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611c5a919061311c565b611c64908261326c565b604051634f614dc160e11b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b031690639ec29b829060240160206040518083038186803b158015611cc757600080fd5b505afa158015611cdb573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611cff919061311c565b611d09908261326c565b60405163059281d360e11b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b031690630b2503a69060240160206040518083038186803b158015611d6c57600080fd5b505afa158015611d80573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611da4919061311c565b611dae908261326c565b60405163216cec3b60e11b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b0316906342d9d8769060240160206040518083038186803b158015611e1157600080fd5b505afa158015611e25573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611e49919061311c565b611e53908261326c565b6040516346490e8360e11b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b031690638c921d069060240160206040518083038186803b158015611eb657600080fd5b505afa158015611eca573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611eee919061311c565b611ef8908261326c565b604051639347e43f60e01b8152600481018790529091507f00000000000000000000000000000000000000000000000000000000000000006001600160a01b031690639347e43f9060240160206040518083038186803b158015611f5b57600080fd5b505afa158015611f6f573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611f93919061311c565b611f9d908261326c565b905060288110158015611fb1575060328111155b15611fd6576040518060600160405280603c8152602001613443603c91399150612097565b60238110158015611fe8575060378111155b1561200d576040518060600160405280603c815260200161355a603c91399150612097565b601d811015801561201f5750603d8111155b15612044576040518060600160405280603c815260200161347f603c91399150612097565b60188110158015612056575060428111155b1561207b576040518060600160405280603c81526020016134f7603c91399150612097565b6040518060600160405280603c81526020016134bb603c913991505b6120a2600a82613284565b959194509092505050565b6120b7338361242a565b6121295760405162461bcd60e51b815260206004820152603160248201527f4552433732313a207472616e736665722063616c6c6572206973206e6f74206f60448201527f776e6572206e6f7220617070726f76656400000000000000000000000000000060648201526084016108b5565b61213584848484612848565b50505050565b600b5460009061217690600160a01b900461ffff167f00000000000000000000000000000000000000000000000000000000000000006132b7565b61ffff16905090565b6000818152600260205260409020546060906001600160a01b03166121fe5760405162461bcd60e51b815260206004820152602f60248201527f4552433732314d657461646174613a2055524920717565727920666f72206e6f60448201526e3732bc34b9ba32b73a103a37b5b2b760891b60648201526084016108b5565b6000604051806040016040528060048152602001631b9d5b1b60e21b815250905060006040518060600160405280602f8152602001613596602f9139905080612246856126e0565b604051602001612257929190613161565b60408051601f19818403018152919052949350505050565b600b546001600160a01b031633146122c95760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b6001600160a01b0381166123455760405162461bcd60e51b815260206004820152602660248201527f4f776e61626c653a206e6577206f776e657220697320746865207a65726f206160448201527f646472657373000000000000000000000000000000000000000000000000000060648201526084016108b5565b6116ab816127f6565b60006001600160e01b031982166380ac58cd60e01b148061237f57506001600160e01b03198216635b5e139f60e01b145b806107a857506301ffc9a760e01b6001600160e01b03198316146107a8565b6123b88282604051806020016040528060008152506128c6565b5050565b600081815260046020526040902080546001600160a01b0319166001600160a01b03841690811790915581906123f182611401565b6001600160a01b03167f8c5be1e5ebec7d5bd14f71427d1e84f3dd0314c0f7b2291e5b200ac8c7c3b92560405160405180910390a45050565b6000818152600260205260408120546001600160a01b03166124a35760405162461bcd60e51b815260206004820152602c60248201527f4552433732313a206f70657261746f7220717565727920666f72206e6f6e657860448201526b34b9ba32b73a103a37b5b2b760a11b60648201526084016108b5565b60006124ae83611401565b9050806001600160a01b0316846001600160a01b031614806124e95750836001600160a01b03166124de84610840565b6001600160a01b0316145b8061251957506001600160a01b0380821660009081526005602090815260408083209388168352929052205460ff165b949350505050565b826001600160a01b031661253482611401565b6001600160a01b0316146125b05760405162461bcd60e51b815260206004820152602960248201527f4552433732313a207472616e73666572206f6620746f6b656e2074686174206960448201527f73206e6f74206f776e000000000000000000000000000000000000000000000060648201526084016108b5565b6001600160a01b0382166126125760405162461bcd60e51b8152602060048201526024808201527f4552433732313a207472616e7366657220746f20746865207a65726f206164646044820152637265737360e01b60648201526084016108b5565b61261d838383612944565b6126286000826123bc565b6001600160a01b03831660009081526003602052604081208054600192906126519084906132da565b90915550506001600160a01b038216600090815260036020526040812080546001929061267f90849061326c565b909155505060008181526002602052604080822080546001600160a01b0319166001600160a01b0386811691821790925591518493918716917fddf252ad1be2c89b69c2b068fc378daa952ba7f163c4a11628f55a4df523b3ef91a4505050565b6060816127045750506040805180820190915260018152600360fc1b602082015290565b8160005b811561272e57806127188161337a565b91506127279050600a83613284565b9150612708565b60008167ffffffffffffffff81111561274957612749613401565b6040519080825280601f01601f191660200182016040528015612773576020820181803683370190505b5090505b8415612519576127886001836132da565b9150612795600a86613395565b6127a090603061326c565b60f81b8183815181106127b5576127b56133eb565b60200101907effffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff1916908160001a9053506127ef600a86613284565b9450612777565b600b80546001600160a01b038381166001600160a01b0319831681179093556040519116919082907f8be0079c531659141344cd1fd0a4f28419497f9722a3daafe3b4186f6b6457e090600090a35050565b612853848484612521565b61285f848484846129fc565b6121355760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b6128d08383612b54565b6128dd60008484846129fc565b610cea5760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b6001600160a01b03831661299f5761299a81600880546000838152600960205260408120829055600182018355919091527ff3f7a9fe364faab93b216da50a3214154f22a0a2b415b23a84c8169e8b636ee30155565b6129c2565b816001600160a01b0316836001600160a01b0316146129c2576129c28382612ca2565b6001600160a01b0382166129d957610cea81612d3f565b826001600160a01b0316826001600160a01b031614610cea57610cea8282612dee565b60006001600160a01b0384163b15612b4957604051630a85bd0160e11b81526001600160a01b0385169063150b7a0290612a409033908990889088906004016131e7565b602060405180830381600087803b158015612a5a57600080fd5b505af1925050508015612a8a575060408051601f3d908101601f19168201909252612a87918101906130e6565b60015b612b2f573d808015612ab8576040519150601f19603f3d011682016040523d82523d6000602084013e612abd565b606091505b508051612b275760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b805181602001fd5b6001600160e01b031916630a85bd0160e11b149050612519565b506001949350505050565b6001600160a01b038216612baa5760405162461bcd60e51b815260206004820181905260248201527f4552433732313a206d696e7420746f20746865207a65726f206164647265737360448201526064016108b5565b6000818152600260205260409020546001600160a01b031615612c0f5760405162461bcd60e51b815260206004820152601c60248201527f4552433732313a20746f6b656e20616c7265616479206d696e7465640000000060448201526064016108b5565b612c1b60008383612944565b6001600160a01b0382166000908152600360205260408120805460019290612c4490849061326c565b909155505060008181526002602052604080822080546001600160a01b0319166001600160a01b03861690811790915590518392907fddf252ad1be2c89b69c2b068fc378daa952ba7f163c4a11628f55a4df523b3ef908290a45050565b60006001612caf8461148c565b612cb991906132da565b600083815260076020526040902054909150808214612d0c576001600160a01b03841660009081526006602090815260408083208584528252808320548484528184208190558352600790915290208190555b5060009182526007602090815260408084208490556001600160a01b039094168352600681528383209183525290812055565b600854600090612d51906001906132da565b60008381526009602052604081205460088054939450909284908110612d7957612d796133eb565b906000526020600020015490508060088381548110612d9a57612d9a6133eb565b6000918252602080832090910192909255828152600990915260408082208490558582528120556008805480612dd257612dd26133d5565b6001900381819060005260206000200160009055905550505050565b6000612df98361148c565b6001600160a01b039093166000908152600660209081526040808320868452825280832085905593825260079052919091209190915550565b604051806101c00160405280600e905b6060815260200190600190039081612e425790505090565b600060208284031215612e6c57600080fd5b8135612e7781613417565b9392505050565b600060208284031215612e9057600080fd5b8151612e7781613417565b60008060408385031215612eae57600080fd5b8235612eb981613417565b91506020830135612ec981613417565b809150509250929050565b600080600060608486031215612ee957600080fd5b8335612ef481613417565b92506020840135612f0481613417565b929592945050506040919091013590565b60008060008060808587031215612f2b57600080fd5b8435612f3681613417565b93506020850135612f4681613417565b925060408501359150606085013567ffffffffffffffff80821115612f6a57600080fd5b818701915087601f830112612f7e57600080fd5b813581811115612f9057612f90613401565b604051601f8201601f19908116603f01168101908382118183101715612fb857612fb8613401565b816040528281528a6020848701011115612fd157600080fd5b82602086016020830137600060208483010152809550505050505092959194509250565b6000806040838503121561300857600080fd5b823561301381613417565b915060208301358015158114612ec957600080fd5b6000806040838503121561303b57600080fd5b823561304681613417565b946020939093013593505050565b6000806020838503121561306757600080fd5b823567ffffffffffffffff8082111561307f57600080fd5b818501915085601f83011261309357600080fd5b8135818111156130a257600080fd5b8660208260051b85010111156130b757600080fd5b60209290920196919550909350505050565b6000602082840312156130db57600080fd5b8135612e778161342c565b6000602082840312156130f857600080fd5b8151612e778161342c565b60006020828403121561311557600080fd5b5035919050565b60006020828403121561312e57600080fd5b5051919050565b6000815180845261314d8160208601602086016132f1565b601f01601f19169290920160200192915050565b600083516131738184602088016132f1565b8351908301906131878183602088016132f1565b01949350505050565b600085516131a2818460208a016132f1565b8551908301906131b6818360208a016132f1565b85519101906131c98183602089016132f1565b84519101906131dc8183602088016132f1565b019695505050505050565b60006001600160a01b038087168352808616602084015250836040830152608060608301526132196080830184613135565b9695505050505050565b602081526000612e776020830184613135565b8281526040602082015260006125196040830184613135565b600061ffff808316818516808303821115613187576131876133a9565b6000821982111561327f5761327f6133a9565b500190565b600082613293576132936133bf565b500490565b60008160001904831182151516156132b2576132b26133a9565b500290565b600061ffff838116908316818110156132d2576132d26133a9565b039392505050565b6000828210156132ec576132ec6133a9565b500390565b60005b8381101561330c5781810151838201526020016132f4565b838111156121355750506000910152565b600181811c9082168061333157607f821691505b6020821081141561335257634e487b7160e01b600052602260045260246000fd5b50919050565b600061ffff80831681811415613370576133706133a9565b6001019392505050565b600060001982141561338e5761338e6133a9565b5060010190565b6000826133a4576133a46133bf565b500690565b634e487b7160e01b600052601160045260246000fd5b634e487b7160e01b600052601260045260246000fd5b634e487b7160e01b600052603160045260246000fd5b634e487b7160e01b600052603260045260246000fd5b634e487b7160e01b600052604160045260246000fd5b6001600160a01b03811681146116ab57600080fd5b6001600160e01b0319811681146116ab57600080fdfe63746767746761746767676374677474746174746761616361616361617461746367637467616361637461677467616361676163616763637463746174616367637461746174637463636361636363636367636761746374746767637463636763746161616361636163746361676767746161636163636767676163747474616163746363617461636161616161636774616761636763746363636363616174746761616763746761676763617474616161746167637461676163676161616774636363636774676761636361636367746163616361616374637461747461636374636361616774746763616761636768747470733a2f2f6e7468706c612e6e65742f6170692f67656e65726174653f73616d706c653d67676167677474746163636363676363637463677467616367746361676163746763746363636163746767616774616774636163616167616361636368747470733a2f2f6e74682d706c616e65742d6170692e6865726f6b756170702e636f6d2f6170692f746f6b656e2fa164736f6c6343000806000a00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d6

0x60806040526004361061026a5760003560e01c80636a4c19d911610153578063a22cb465116100cb578063c87b56dd1161007f578063e985e9c511610064578063e985e9c5146106e6578063f2fde38b1461072f578063f82cbbe81461074f57600080fd5b8063c87b56dd14610692578063daf5d374146106b257600080fd5b8063ae5a583f116100b0578063ae5a583f14610647578063b88d4fde1461065d578063c5de34a01461067d57600080fd5b8063a22cb465146105f9578063ab84c4ed1461061957600080fd5b8063853828b61161012257806391ba317a1161010757806391ba317a146105bc57806395d89b41146105d1578063a0712d68146105e657600080fd5b8063853828b6146105895780638da5cb5b1461059e57600080fd5b80636a4c19d91461050b57806370a082311461053f578063715018a61461055f5780638416b6961461057457600080fd5b80632ab4d052116101e657806347febae8116101b55780634f6ccce71161019a5780634f6ccce7146104b65780635d929f70146104d65780636352211e146104eb57600080fd5b806347febae8146104815780634c81433f1461049457600080fd5b80632ab4d052146103d95780632e52d6061461040d5780632f745c591461044157806342842e0e1461046157600080fd5b8063095ea7b31161023d57806320bc84ce1161022257806320bc84ce1461035257806323b872dd14610399578063261ab1d7146103b957600080fd5b8063095ea7b31461031357806318160ddd1461033357600080fd5b806301ffc9a71461026f57806306fdde03146102a4578063081812fc146102c65780630860b12c146102fe575b600080fd5b34801561027b57600080fd5b5061028f61028a3660046130c9565b610783565b60405190151581526020015b60405180910390f35b3480156102b057600080fd5b506102b96107ae565b60405161029b9190613223565b3480156102d257600080fd5b506102e66102e1366004613103565b610840565b6040516001600160a01b03909116815260200161029b565b61031161030c366004613103565b6108da565b005b34801561031f57600080fd5b5061031161032e366004613028565b610bd9565b34801561033f57600080fd5b506008545b60405190815260200161029b565b34801561035e57600080fd5b506103867f00000000000000000000000000000000000000000000000000000000000022b881565b60405161ffff909116815260200161029b565b3480156103a557600080fd5b506103116103b4366004612ed4565b610cef565b3480156103c557600080fd5b506102b96103d4366004613103565b610d76565b3480156103e557600080fd5b506103447f000000000000000000000000000000000000000000000000000000000000271081565b34801561041957600080fd5b506102e67f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d681565b34801561044d57600080fd5b5061034461045c366004613028565b610eb2565b34801561046d57600080fd5b5061031161047c366004612ed4565b610f5a565b61031161048f366004613054565b610f75565b3480156104a057600080fd5b50600b5461038690600160a01b900461ffff1681565b3480156104c257600080fd5b506103446104d1366004613103565b61135d565b3480156104e257600080fd5b50610344602081565b3480156104f757600080fd5b506102e6610506366004613103565b611401565b34801561051757600080fd5b5061028f7f000000000000000000000000000000000000000000000000000000000000000081565b34801561054b57600080fd5b5061034461055a366004612e5a565b61148c565b34801561056b57600080fd5b50610311611526565b34801561058057600080fd5b5061034461158c565b34801561059557600080fd5b50610311611618565b3480156105aa57600080fd5b50600b546001600160a01b03166102e6565b3480156105c857600080fd5b506103446116ae565b3480156105dd57600080fd5b506102b9611713565b6103116105f4366004613103565b611722565b34801561060557600080fd5b50610311610614366004612ff5565b6119b3565b34801561062557600080fd5b50610639610634366004613103565b611a78565b60405161029b929190613236565b34801561065357600080fd5b506103446122b881565b34801561066957600080fd5b50610311610678366004612f15565b6120ad565b34801561068957600080fd5b5061034461213b565b34801561069e57600080fd5b506102b96106ad366004613103565b61217f565b3480156106be57600080fd5b506103447f0000000000000000000000000000000000000000000000000058d15e1762800081565b3480156106f257600080fd5b5061028f610701366004612e9b565b6001600160a01b03918216600090815260056020908152604080832093909416825291909152205460ff1690565b34801561073b57600080fd5b5061031161074a366004612e5a565b61226f565b34801561075b57600080fd5b506103447f00000000000000000000000000000000000000000000000000b1a2bc2ec5000081565b60006001600160e01b0319821663780e9d6360e01b14806107a857506107a88261234e565b92915050565b6060600080546107bd9061331d565b80601f01602080910402602001604051908101604052809291908181526020018280546107e99061331d565b80156108365780601f1061080b57610100808354040283529160200191610836565b820191906000526020600020905b81548152906001019060200180831161081957829003601f168201915b5050505050905090565b6000818152600260205260408120546001600160a01b03166108be5760405162461bcd60e51b815260206004820152602c60248201527f4552433732313a20617070726f76656420717565727920666f72206e6f6e657860448201526b34b9ba32b73a103a37b5b2b760a11b60648201526084015b60405180910390fd5b506000908152600460205260409020546001600160a01b031690565b6002600a54141561092d5760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a5561ffff7f00000000000000000000000000000000000000000000000000000000000022b81615801561098b57507f000000000000000000000000000000000000000000000000000000000000271061098960085490565b105b806109c55750600b5461ffff7f00000000000000000000000000000000000000000000000000000000000022b88116600160a01b90920416105b610a115760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b6040516331a9108f60e11b81526004810182905233906001600160a01b037f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d61690636352211e9060240160206040518083038186803b158015610a7357600080fd5b505afa158015610a87573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190610aab9190612e7e565b6001600160a01b031614610b015760405162461bcd60e51b815260206004820152601360248201527f4e506173733a494e56414c49445f4f574e45520000000000000000000000000060448201526064016108b5565b7f0000000000000000000000000000000000000000000000000058d15e176280003414610b665760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b61ffff7f00000000000000000000000000000000000000000000000000000000000022b81615610bc757600b8054600160a01b900461ffff16906014610bab83613358565b91906101000a81548161ffff021916908361ffff160217905550505b610bd1338261239e565b506001600a55565b6000610be482611401565b9050806001600160a01b0316836001600160a01b03161415610c525760405162461bcd60e51b815260206004820152602160248201527f4552433732313a20617070726f76616c20746f2063757272656e74206f776e656044820152603960f91b60648201526084016108b5565b336001600160a01b0382161480610c6e5750610c6e8133610701565b610ce05760405162461bcd60e51b815260206004820152603860248201527f4552433732313a20617070726f76652063616c6c6572206973206e6f74206f7760448201527f6e6572206e6f7220617070726f76656420666f7220616c6c000000000000000060648201526084016108b5565b610cea83836123bc565b505050565b610cf9338261242a565b610d6b5760405162461bcd60e51b815260206004820152603160248201527f4552433732313a207472616e736665722063616c6c6572206973206e6f74206f60448201527f776e6572206e6f7220617070726f76656400000000000000000000000000000060648201526084016108b5565b610cea838383612521565b6000818152600260205260409020546060906001600160a01b0316610df55760405162461bcd60e51b815260206004820152602f60248201527f4552433732314d657461646174613a2055524920717565727920666f72206e6f60448201526e3732bc34b9ba32b73a103a37b5b2b760891b60648201526084016108b5565b600080610e0184611a78565b91509150610e0d612e32565b6040518060600160405280602781526020016135336027913981526020808201839052604080518082018252600b81527f2b696e74656e736974793d00000000000000000000000000000000000000000092810192909252820152610e71836126e0565b6060820181905281516020808401516040808601519051600095610e989594909101613190565b60408051601f198184030181529190529695505050505050565b6000610ebd8361148c565b8210610f315760405162461bcd60e51b815260206004820152602b60248201527f455243373231456e756d657261626c653a206f776e657220696e646578206f7560448201527f74206f6620626f756e647300000000000000000000000000000000000000000060648201526084016108b5565b506001600160a01b03919091166000908152600660209081526040808320938352929052205490565b610cea838383604051806020016040528060008152506120ad565b6002600a541415610fc85760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a5580602081111561101f5760405162461bcd60e51b815260206004820152600f60248201527f4e506173733a544f4f5f4c41524745000000000000000000000000000000000060448201526064016108b5565b61ffff7f00000000000000000000000000000000000000000000000000000000000022b81615801561108457507f00000000000000000000000000000000000000000000000000000000000027108161107760085490565b611081919061326c565b11155b806110ca5750600b5461ffff7f00000000000000000000000000000000000000000000000000000000000022b88116916110c7918491600160a01b90041661326c565b11155b6111165760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b611140817f0000000000000000000000000000000000000000000000000058d15e17628000613298565b34146111845760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b60005b818110156112ae57337f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b0316636352211e8686858181106111d1576111d16133eb565b905060200201356040518263ffffffff1660e01b81526004016111f691815260200190565b60206040518083038186803b15801561120e57600080fd5b505afa158015611222573d6000803e3d6000fd5b505050506040513d601f19601f820116820180604052508101906112469190612e7e565b6001600160a01b03161461129c5760405162461bcd60e51b815260206004820152601360248201527f4e506173733a494e56414c49445f4f574e45520000000000000000000000000060448201526064016108b5565b806112a68161337a565b915050611187565b5061ffff7f00000000000000000000000000000000000000000000000000000000000022b816156113135780600b60148282829054906101000a900461ffff166112f8919061324f565b92506101000a81548161ffff021916908361ffff1602179055505b60005b818110156113525761134033858584818110611334576113346133eb565b9050602002013561239e565b8061134a8161337a565b915050611316565b50506001600a555050565b600061136860085490565b82106113dc5760405162461bcd60e51b815260206004820152602c60248201527f455243373231456e756d657261626c653a20676c6f62616c20696e646578206f60448201527f7574206f6620626f756e6473000000000000000000000000000000000000000060648201526084016108b5565b600882815481106113ef576113ef6133eb565b90600052602060002001549050919050565b6000818152600260205260408120546001600160a01b0316806107a85760405162461bcd60e51b815260206004820152602960248201527f4552433732313a206f776e657220717565727920666f72206e6f6e657869737460448201527f656e7420746f6b656e000000000000000000000000000000000000000000000060648201526084016108b5565b60006001600160a01b03821661150a5760405162461bcd60e51b815260206004820152602a60248201527f4552433732313a2062616c616e636520717565727920666f7220746865207a6560448201527f726f20616464726573730000000000000000000000000000000000000000000060648201526084016108b5565b506001600160a01b031660009081526003602052604090205490565b600b546001600160a01b031633146115805760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b61158a60006127f6565b565b6000806115dd61ffff7f00000000000000000000000000000000000000000000000000000000000022b8167f00000000000000000000000000000000000000000000000000000000000027106132da565b600b5490915060009061ffff600160a01b909104166115fb60085490565b61160591906132da565b905061161181836132da565b9250505090565b600b546001600160a01b031633146116725760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b600b546040516001600160a01b03909116904780156108fc02916000818181858888f193505050501580156116ab573d6000803e3d6000fd5b50565b6000806116ff61ffff7f00000000000000000000000000000000000000000000000000000000000022b8167f00000000000000000000000000000000000000000000000000000000000027106132da565b905061170d816122b861326c565b91505090565b6060600180546107bd9061331d565b6002600a5414156117755760405162461bcd60e51b815260206004820152601f60248201527f5265656e7472616e637947756172643a207265656e7472616e742063616c6c0060448201526064016108b5565b6002600a557f0000000000000000000000000000000000000000000000000000000000000000156117e85760405162461bcd60e51b815260206004820152601b60248201527f4e506173733a4f50454e5f4d494e54494e475f44495341424c4544000000000060448201526064016108b5565b60006117f261158c565b1161183f5760405162461bcd60e51b815260206004820152601c60248201527f4e506173733a4d41585f414c4c4f434154494f4e5f524541434845440000000060448201526064016108b5565b6122b88111801561185757506118536116ae565b8111155b8061190257506040516331a9108f60e11b81526004810182905233906001600160a01b037f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d61690636352211e9060240160206040518083038186803b1580156118bf57600080fd5b505afa1580156118d3573d6000803e3d6000fd5b505050506040513d601f19601f820116820180604052508101906118f79190612e7e565b6001600160a01b0316145b61194e5760405162461bcd60e51b815260206004820152601060248201527f4e506173733a494e56414c49445f49440000000000000000000000000000000060448201526064016108b5565b7f00000000000000000000000000000000000000000000000000b1a2bc2ec500003414610bc75760405162461bcd60e51b81526020600482015260136024820152724e506173733a494e56414c49445f505249434560681b60448201526064016108b5565b6001600160a01b038216331415611a0c5760405162461bcd60e51b815260206004820152601960248201527f4552433732313a20617070726f766520746f2063616c6c65720000000000000060448201526064016108b5565b3360008181526005602090815260408083206001600160a01b03871680855290835292819020805460ff191686151590811790915590519081529192917f17307eab39ab6107e8899845ad3d59bd9653f200f220920489ca2b5937696c31910160405180910390a35050565b600060608060007f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b0316638aa001fc866040518263ffffffff1660e01b8152600401611acd91815260200190565b60206040518083038186803b158015611ae557600080fd5b505afa158015611af9573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611b1d919061311c565b60405163667386f760e01b8152600481018790527f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b03169063667386f79060240160206040518083038186803b158015611b7d57600080fd5b505afa158015611b91573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611bb5919061311c565b611bbf919061326c565b60405163fa7f71b160e01b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b03169063fa7f71b19060240160206040518083038186803b158015611c2257600080fd5b505afa158015611c36573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611c5a919061311c565b611c64908261326c565b604051634f614dc160e11b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b031690639ec29b829060240160206040518083038186803b158015611cc757600080fd5b505afa158015611cdb573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611cff919061311c565b611d09908261326c565b60405163059281d360e11b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b031690630b2503a69060240160206040518083038186803b158015611d6c57600080fd5b505afa158015611d80573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611da4919061311c565b611dae908261326c565b60405163216cec3b60e11b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b0316906342d9d8769060240160206040518083038186803b158015611e1157600080fd5b505afa158015611e25573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611e49919061311c565b611e53908261326c565b6040516346490e8360e11b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b031690638c921d069060240160206040518083038186803b158015611eb657600080fd5b505afa158015611eca573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611eee919061311c565b611ef8908261326c565b604051639347e43f60e01b8152600481018790529091507f00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d66001600160a01b031690639347e43f9060240160206040518083038186803b158015611f5b57600080fd5b505afa158015611f6f573d6000803e3d6000fd5b505050506040513d601f19601f82011682018060405250810190611f93919061311c565b611f9d908261326c565b905060288110158015611fb1575060328111155b15611fd6576040518060600160405280603c8152602001613443603c91399150612097565b60238110158015611fe8575060378111155b1561200d576040518060600160405280603c815260200161355a603c91399150612097565b601d811015801561201f5750603d8111155b15612044576040518060600160405280603c815260200161347f603c91399150612097565b60188110158015612056575060428111155b1561207b576040518060600160405280603c81526020016134f7603c91399150612097565b6040518060600160405280603c81526020016134bb603c913991505b6120a2600a82613284565b959194509092505050565b6120b7338361242a565b6121295760405162461bcd60e51b815260206004820152603160248201527f4552433732313a207472616e736665722063616c6c6572206973206e6f74206f60448201527f776e6572206e6f7220617070726f76656400000000000000000000000000000060648201526084016108b5565b61213584848484612848565b50505050565b600b5460009061217690600160a01b900461ffff167f00000000000000000000000000000000000000000000000000000000000022b86132b7565b61ffff16905090565b6000818152600260205260409020546060906001600160a01b03166121fe5760405162461bcd60e51b815260206004820152602f60248201527f4552433732314d657461646174613a2055524920717565727920666f72206e6f60448201526e3732bc34b9ba32b73a103a37b5b2b760891b60648201526084016108b5565b6000604051806040016040528060048152602001631b9d5b1b60e21b815250905060006040518060600160405280602f8152602001613596602f9139905080612246856126e0565b604051602001612257929190613161565b60408051601f19818403018152919052949350505050565b600b546001600160a01b031633146122c95760405162461bcd60e51b815260206004820181905260248201527f4f776e61626c653a2063616c6c6572206973206e6f7420746865206f776e657260448201526064016108b5565b6001600160a01b0381166123455760405162461bcd60e51b815260206004820152602660248201527f4f776e61626c653a206e6577206f776e657220697320746865207a65726f206160448201527f646472657373000000000000000000000000000000000000000000000000000060648201526084016108b5565b6116ab816127f6565b60006001600160e01b031982166380ac58cd60e01b148061237f57506001600160e01b03198216635b5e139f60e01b145b806107a857506301ffc9a760e01b6001600160e01b03198316146107a8565b6123b88282604051806020016040528060008152506128c6565b5050565b600081815260046020526040902080546001600160a01b0319166001600160a01b03841690811790915581906123f182611401565b6001600160a01b03167f8c5be1e5ebec7d5bd14f71427d1e84f3dd0314c0f7b2291e5b200ac8c7c3b92560405160405180910390a45050565b6000818152600260205260408120546001600160a01b03166124a35760405162461bcd60e51b815260206004820152602c60248201527f4552433732313a206f70657261746f7220717565727920666f72206e6f6e657860448201526b34b9ba32b73a103a37b5b2b760a11b60648201526084016108b5565b60006124ae83611401565b9050806001600160a01b0316846001600160a01b031614806124e95750836001600160a01b03166124de84610840565b6001600160a01b0316145b8061251957506001600160a01b0380821660009081526005602090815260408083209388168352929052205460ff165b949350505050565b826001600160a01b031661253482611401565b6001600160a01b0316146125b05760405162461bcd60e51b815260206004820152602960248201527f4552433732313a207472616e73666572206f6620746f6b656e2074686174206960448201527f73206e6f74206f776e000000000000000000000000000000000000000000000060648201526084016108b5565b6001600160a01b0382166126125760405162461bcd60e51b8152602060048201526024808201527f4552433732313a207472616e7366657220746f20746865207a65726f206164646044820152637265737360e01b60648201526084016108b5565b61261d838383612944565b6126286000826123bc565b6001600160a01b03831660009081526003602052604081208054600192906126519084906132da565b90915550506001600160a01b038216600090815260036020526040812080546001929061267f90849061326c565b909155505060008181526002602052604080822080546001600160a01b0319166001600160a01b0386811691821790925591518493918716917fddf252ad1be2c89b69c2b068fc378daa952ba7f163c4a11628f55a4df523b3ef91a4505050565b6060816127045750506040805180820190915260018152600360fc1b602082015290565b8160005b811561272e57806127188161337a565b91506127279050600a83613284565b9150612708565b60008167ffffffffffffffff81111561274957612749613401565b6040519080825280601f01601f191660200182016040528015612773576020820181803683370190505b5090505b8415612519576127886001836132da565b9150612795600a86613395565b6127a090603061326c565b60f81b8183815181106127b5576127b56133eb565b60200101907effffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff1916908160001a9053506127ef600a86613284565b9450612777565b600b80546001600160a01b038381166001600160a01b0319831681179093556040519116919082907f8be0079c531659141344cd1fd0a4f28419497f9722a3daafe3b4186f6b6457e090600090a35050565b612853848484612521565b61285f848484846129fc565b6121355760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b6128d08383612b54565b6128dd60008484846129fc565b610cea5760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b6001600160a01b03831661299f5761299a81600880546000838152600960205260408120829055600182018355919091527ff3f7a9fe364faab93b216da50a3214154f22a0a2b415b23a84c8169e8b636ee30155565b6129c2565b816001600160a01b0316836001600160a01b0316146129c2576129c28382612ca2565b6001600160a01b0382166129d957610cea81612d3f565b826001600160a01b0316826001600160a01b031614610cea57610cea8282612dee565b60006001600160a01b0384163b15612b4957604051630a85bd0160e11b81526001600160a01b0385169063150b7a0290612a409033908990889088906004016131e7565b602060405180830381600087803b158015612a5a57600080fd5b505af1925050508015612a8a575060408051601f3d908101601f19168201909252612a87918101906130e6565b60015b612b2f573d808015612ab8576040519150601f19603f3d011682016040523d82523d6000602084013e612abd565b606091505b508051612b275760405162461bcd60e51b815260206004820152603260248201527f4552433732313a207472616e7366657220746f206e6f6e20455243373231526560448201527131b2b4bb32b91034b6b83632b6b2b73a32b960711b60648201526084016108b5565b805181602001fd5b6001600160e01b031916630a85bd0160e11b149050612519565b506001949350505050565b6001600160a01b038216612baa5760405162461bcd60e51b815260206004820181905260248201527f4552433732313a206d696e7420746f20746865207a65726f206164647265737360448201526064016108b5565b6000818152600260205260409020546001600160a01b031615612c0f5760405162461bcd60e51b815260206004820152601c60248201527f4552433732313a20746f6b656e20616c7265616479206d696e7465640000000060448201526064016108b5565b612c1b60008383612944565b6001600160a01b0382166000908152600360205260408120805460019290612c4490849061326c565b909155505060008181526002602052604080822080546001600160a01b0319166001600160a01b03861690811790915590518392907fddf252ad1be2c89b69c2b068fc378daa952ba7f163c4a11628f55a4df523b3ef908290a45050565b60006001612caf8461148c565b612cb991906132da565b600083815260076020526040902054909150808214612d0c576001600160a01b03841660009081526006602090815260408083208584528252808320548484528184208190558352600790915290208190555b5060009182526007602090815260408084208490556001600160a01b039094168352600681528383209183525290812055565b600854600090612d51906001906132da565b60008381526009602052604081205460088054939450909284908110612d7957612d796133eb565b906000526020600020015490508060088381548110612d9a57612d9a6133eb565b6000918252602080832090910192909255828152600990915260408082208490558582528120556008805480612dd257612dd26133d5565b6001900381819060005260206000200160009055905550505050565b6000612df98361148c565b6001600160a01b039093166000908152600660209081526040808320868452825280832085905593825260079052919091209190915550565b604051806101c00160405280600e905b6060815260200190600190039081612e425790505090565b600060208284031215612e6c57600080fd5b8135612e7781613417565b9392505050565b600060208284031215612e9057600080fd5b8151612e7781613417565b60008060408385031215612eae57600080fd5b8235612eb981613417565b91506020830135612ec981613417565b809150509250929050565b600080600060608486031215612ee957600080fd5b8335612ef481613417565b92506020840135612f0481613417565b929592945050506040919091013590565b60008060008060808587031215612f2b57600080fd5b8435612f3681613417565b93506020850135612f4681613417565b925060408501359150606085013567ffffffffffffffff80821115612f6a57600080fd5b818701915087601f830112612f7e57600080fd5b813581811115612f9057612f90613401565b604051601f8201601f19908116603f01168101908382118183101715612fb857612fb8613401565b816040528281528a6020848701011115612fd157600080fd5b82602086016020830137600060208483010152809550505050505092959194509250565b6000806040838503121561300857600080fd5b823561301381613417565b915060208301358015158114612ec957600080fd5b6000806040838503121561303b57600080fd5b823561304681613417565b946020939093013593505050565b6000806020838503121561306757600080fd5b823567ffffffffffffffff8082111561307f57600080fd5b818501915085601f83011261309357600080fd5b8135818111156130a257600080fd5b8660208260051b85010111156130b757600080fd5b60209290920196919550909350505050565b6000602082840312156130db57600080fd5b8135612e778161342c565b6000602082840312156130f857600080fd5b8151612e778161342c565b60006020828403121561311557600080fd5b5035919050565b60006020828403121561312e57600080fd5b5051919050565b6000815180845261314d8160208601602086016132f1565b601f01601f19169290920160200192915050565b600083516131738184602088016132f1565b8351908301906131878183602088016132f1565b01949350505050565b600085516131a2818460208a016132f1565b8551908301906131b6818360208a016132f1565b85519101906131c98183602089016132f1565b84519101906131dc8183602088016132f1565b019695505050505050565b60006001600160a01b038087168352808616602084015250836040830152608060608301526132196080830184613135565b9695505050505050565b602081526000612e776020830184613135565b8281526040602082015260006125196040830184613135565b600061ffff808316818516808303821115613187576131876133a9565b6000821982111561327f5761327f6133a9565b500190565b600082613293576132936133bf565b500490565b60008160001904831182151516156132b2576132b26133a9565b500290565b600061ffff838116908316818110156132d2576132d26133a9565b039392505050565b6000828210156132ec576132ec6133a9565b500390565b60005b8381101561330c5781810151838201526020016132f4565b838111156121355750506000910152565b600181811c9082168061333157607f821691505b6020821081141561335257634e487b7160e01b600052602260045260246000fd5b50919050565b600061ffff80831681811415613370576133706133a9565b6001019392505050565b600060001982141561338e5761338e6133a9565b5060010190565b6000826133a4576133a46133bf565b500690565b634e487b7160e01b600052601160045260246000fd5b634e487b7160e01b600052601260045260246000fd5b634e487b7160e01b600052603160045260246000fd5b634e487b7160e01b600052603260045260246000fd5b634e487b7160e01b600052604160045260246000fd5b6001600160a01b03811681146116ab57600080fd5b6001600160e01b0319811681146116ab57600080fdfe63746767746761746767676374677474746174746761616361616361617461746367637467616361637461677467616361676163616763637463746174616367637461746174637463636361636363636367636761746374746767637463636763746161616361636163746361676767746161636163636767676163747474616163746363617461636161616161636774616761636763746363636363616174746761616763746761676763617474616161746167637461676163676161616774636363636774676761636361636367746163616361616374637461747461636374636361616774746763616761636768747470733a2f2f6e7468706c612e6e65742f6170692f67656e65726174653f73616d706c653d67676167677474746163636363676363637463677467616367746361676163746763746363636163746767616774616774636163616167616361636368747470733a2f2f6e74682d706c616e65742d6170692e6865726f6b756170702e636f6d2f6170692f746f6b656e2fa164736f6c6343000806000a

00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d6

-----Decoded View---------------
Arg [0] : _nContractAddress (address): 0x05a46f1E545526FB803FF974C790aCeA34D1f2D6

-----Encoded View---------------
1 Constructor Arguments found :
Arg [0] : 00000000000000000000000005a46f1e545526fb803ff974c790acea34d1f2d6